Incidental Mutation 'R5320:Rnf141'
ID406049
Institutional Source Beutler Lab
Gene Symbol Rnf141
Ensembl Gene ENSMUSG00000030788
Gene Namering finger protein 141
Synonyms2610110L04Rik, ZFP36, ZNF230
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location110800432-110844457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110833803 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 62 (F62L)
Ref Sequence ENSEMBL: ENSMUSP00000134917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106682] [ENSMUST00000175981] [ENSMUST00000176716] [ENSMUST00000176746] [ENSMUST00000177236] [ENSMUST00000177462] [ENSMUST00000177520]
Predicted Effect probably damaging
Transcript: ENSMUST00000106682
AA Change: F62L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102293
Gene: ENSMUSG00000030788
AA Change: F62L

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175981
SMART Domains Protein: ENSMUSP00000135123
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
RING 58 94 3.39e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176716
AA Change: F62L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000176746
Predicted Effect probably damaging
Transcript: ENSMUST00000177236
AA Change: F62L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134781
Gene: ENSMUSG00000030788
AA Change: F62L

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177462
AA Change: F62L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134917
Gene: ENSMUSG00000030788
AA Change: F62L

DomainStartEndE-ValueType
PDB:2ECN|A 144 180 3e-21 PDB
SCOP:d1fbva4 146 180 3e-7 SMART
Blast:RING 155 180 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177520
AA Change: F62L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. Abundant expression of this gene was found in the testicular tissue of fertile men, but was not detected in azoospermic patients. Studies of the mouse counterpart suggest that this gene may function as a testis specific transcription factor during spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit decreased litter size but normal spermatogeness and testes weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Rnf141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rnf141 APN 7 110833734 unclassified probably benign
IGL02246:Rnf141 APN 7 110825287 missense probably benign
IGL02336:Rnf141 APN 7 110837198 nonsense probably null
R0482:Rnf141 UTSW 7 110837138 nonsense probably null
R1324:Rnf141 UTSW 7 110816843 nonsense probably null
R1718:Rnf141 UTSW 7 110821273 missense probably damaging 1.00
R2067:Rnf141 UTSW 7 110821365 splice site probably benign
R4151:Rnf141 UTSW 7 110837199 missense probably benign 0.19
R4867:Rnf141 UTSW 7 110816768 missense probably damaging 1.00
R4869:Rnf141 UTSW 7 110825350 missense probably damaging 1.00
R4947:Rnf141 UTSW 7 110825320 missense possibly damaging 0.66
R6364:Rnf141 UTSW 7 110821309 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CGACCTTGATGTACCTGTGC -3'
(R):5'- GGAGGCTATTGATTTTCATCACTTC -3'

Sequencing Primer
(F):5'- ACCTTGATGTACCTGTGCATATATAG -3'
(R):5'- GCTATTGATTTTCATCACTTCTGCTG -3'
Posted On2016-07-22