Incidental Mutation 'R5320:Cars2'
ID406052
Institutional Source Beutler Lab
Gene Symbol Cars2
Ensembl Gene ENSMUSG00000056228
Gene Namecysteinyl-tRNA synthetase 2 (mitochondrial)(putative)
SynonymsD530030H10Rik, 2310051N18Rik, 2410044A07Rik
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location11513977-11550783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11517854 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 414 (H414N)
Ref Sequence ENSEMBL: ENSMUSP00000046453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033901] [ENSMUST00000049461] [ENSMUST00000177955] [ENSMUST00000178721] [ENSMUST00000178817] [ENSMUST00000210478] [ENSMUST00000211395]
Predicted Effect probably benign
Transcript: ENSMUST00000033901
SMART Domains Protein: ENSMUSP00000033901
Gene: ENSMUSG00000031505

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Carb_kinase 94 356 6.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049461
AA Change: H414N

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046453
Gene: ENSMUSG00000056228
AA Change: H414N

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:tRNA-synt_1e 50 351 4.1e-116 PFAM
Pfam:tRNA-synt_1g 63 207 1.5e-7 PFAM
Pfam:tRNA-synt_1g 280 370 4.2e-7 PFAM
Blast:DALR_2 391 461 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177955
SMART Domains Protein: ENSMUSP00000136363
Gene: ENSMUSG00000031505

DomainStartEndE-ValueType
Pfam:Carb_kinase 56 319 2.5e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178382
Predicted Effect probably benign
Transcript: ENSMUST00000178721
SMART Domains Protein: ENSMUSP00000136535
Gene: ENSMUSG00000031505

DomainStartEndE-ValueType
Pfam:Carb_kinase 56 242 1.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178817
SMART Domains Protein: ENSMUSP00000137488
Gene: ENSMUSG00000031505

DomainStartEndE-ValueType
Pfam:Carb_kinase 56 79 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210316
Predicted Effect probably benign
Transcript: ENSMUST00000210478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211172
Predicted Effect probably benign
Transcript: ENSMUST00000211395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211406
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele develop induced hyperactivity followed by head bobbing and tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Cars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
madcow UTSW 8 11526034 missense probably damaging 1.00
PIT4810001:Cars2 UTSW 8 11514699 missense probably benign
R0633:Cars2 UTSW 8 11550511 missense probably benign 0.00
R0788:Cars2 UTSW 8 11529672 missense possibly damaging 0.76
R1493:Cars2 UTSW 8 11517817 critical splice donor site probably null
R1559:Cars2 UTSW 8 11530430 splice site probably null
R1846:Cars2 UTSW 8 11514674 missense probably benign 0.03
R1954:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1955:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1993:Cars2 UTSW 8 11514515 missense probably benign 0.03
R2062:Cars2 UTSW 8 11547747 missense probably damaging 1.00
R2153:Cars2 UTSW 8 11530299 missense possibly damaging 0.87
R5004:Cars2 UTSW 8 11518956 unclassified probably null
R6004:Cars2 UTSW 8 11547743 missense probably damaging 1.00
R6089:Cars2 UTSW 8 11530301 missense probably damaging 0.98
R6265:Cars2 UTSW 8 11529599 frame shift probably null
R6267:Cars2 UTSW 8 11529599 frame shift probably null
R6268:Cars2 UTSW 8 11529599 frame shift probably null
R6841:Cars2 UTSW 8 11516198 missense probably benign 0.01
R7076:Cars2 UTSW 8 11529649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAACGTGCAGCAGGCTG -3'
(R):5'- GCAGGTTCCCTTCACTCAAC -3'

Sequencing Primer
(F):5'- CAGGCTGAGCTTGTGAAGAAGTC -3'
(R):5'- GGATTTTGTTACAAAACCGTAAACAC -3'
Posted On2016-07-22