Incidental Mutation 'R5320:Tlr3'
ID406054
Institutional Source Beutler Lab
Gene Symbol Tlr3
Ensembl Gene ENSMUSG00000031639
Gene Nametoll-like receptor 3
Synonyms
MMRRC Submission 042903-MU
Accession Numbers

Ncbi RefSeq: NM_126166; MGI: 2156367

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45395665-45411080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45399100 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 253 (N253K)
Ref Sequence ENSEMBL: ENSMUSP00000147738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034056] [ENSMUST00000167106] [ENSMUST00000209651] [ENSMUST00000209772] [ENSMUST00000210013] [ENSMUST00000210996] [ENSMUST00000211370]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034056
AA Change: N253K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034056
Gene: ENSMUSG00000031639
AA Change: N253K

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167106
AA Change: N253K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126556
Gene: ENSMUSG00000031639
AA Change: N253K

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209651
Predicted Effect possibly damaging
Transcript: ENSMUST00000209772
AA Change: N253K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000210013
Predicted Effect probably benign
Transcript: ENSMUST00000210996
Predicted Effect probably benign
Transcript: ENSMUST00000211370
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show alterations in innate immunity against different viruses, viral pathogenesis, anxiety, hippocampal synaptic plasticity, memory retention and neurogenesis. Homozygotes for another null allele show altered ds-RNA responses in dendritic and aorta smooth muscle cells. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Tlr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tlr3 APN 8 45400690 missense probably damaging 0.99
IGL01820:Tlr3 APN 8 45398339 missense probably benign
IGL02504:Tlr3 APN 8 45397907 missense probably damaging 1.00
IGL02523:Tlr3 APN 8 45398391 unclassified probably null
IGL03166:Tlr3 APN 8 45402928 missense probably benign 0.05
IGL03287:Tlr3 APN 8 45402780 missense probably benign
Rakshasa UTSW 8 45397697 missense probably benign 0.08
Ultraman UTSW 8 45402981 missense probably damaging 1.00
E0354:Tlr3 UTSW 8 45400820 missense probably damaging 1.00
R0960:Tlr3 UTSW 8 45397415 missense probably damaging 1.00
R1175:Tlr3 UTSW 8 45397134 missense probably damaging 1.00
R1332:Tlr3 UTSW 8 45398737 missense probably damaging 0.99
R1477:Tlr3 UTSW 8 45398165 missense probably damaging 1.00
R1667:Tlr3 UTSW 8 45400837 missense probably benign 0.00
R1755:Tlr3 UTSW 8 45397973 missense probably benign
R1996:Tlr3 UTSW 8 45397697 missense probably benign 0.08
R2012:Tlr3 UTSW 8 45402786 missense possibly damaging 0.91
R2288:Tlr3 UTSW 8 45397668 missense probably damaging 0.98
R2895:Tlr3 UTSW 8 45397592 missense possibly damaging 0.89
R3837:Tlr3 UTSW 8 45396939 missense probably damaging 1.00
R4905:Tlr3 UTSW 8 45399223 critical splice acceptor site probably null
R4934:Tlr3 UTSW 8 45397035 missense probably benign 0.10
R5025:Tlr3 UTSW 8 45403038 missense probably benign 0.00
R5086:Tlr3 UTSW 8 45402825 missense probably damaging 0.96
R5129:Tlr3 UTSW 8 45402981 missense probably damaging 1.00
R5411:Tlr3 UTSW 8 45396955 missense probably benign 0.01
R5497:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5498:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5499:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5501:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5731:Tlr3 UTSW 8 45398120 missense probably benign 0.00
R5761:Tlr3 UTSW 8 45402771 missense probably benign 0.00
R5992:Tlr3 UTSW 8 45397814 missense probably benign
R6031:Tlr3 UTSW 8 45398528 missense probably damaging 1.00
R6031:Tlr3 UTSW 8 45398528 missense probably damaging 1.00
R6104:Tlr3 UTSW 8 45403093 missense probably benign 0.00
R6289:Tlr3 UTSW 8 45396929 missense probably benign 0.04
R6372:Tlr3 UTSW 8 45397011 missense probably damaging 1.00
R6470:Tlr3 UTSW 8 45397385 missense probably damaging 1.00
R6486:Tlr3 UTSW 8 45398613 unclassified probably null
R6504:Tlr3 UTSW 8 45397449 missense possibly damaging 0.79
R6721:Tlr3 UTSW 8 45398880 missense probably benign 0.00
R7089:Tlr3 UTSW 8 45397773 missense probably benign 0.02
R7169:Tlr3 UTSW 8 45397019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTACCTCAGGTTGGAGAG -3'
(R):5'- TCCTATGGAGCCAGTTAACTTCTG -3'

Sequencing Primer
(F):5'- GACAGACGCTGTATATTGTTGTACTC -3'
(R):5'- CCAGTTAACTTCTGGGTTTCTTG -3'
Posted On2016-07-22