Incidental Mutation 'R5320:Cdyl2'
ID406055
Institutional Source Beutler Lab
Gene Symbol Cdyl2
Ensembl Gene ENSMUSG00000031758
Gene Namechromodomain protein, Y chromosome-like 2
Synonyms
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location116574400-116732991 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 116595055 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 244 (C244*)
Ref Sequence ENSEMBL: ENSMUSP00000104730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109102]
Predicted Effect probably null
Transcript: ENSMUST00000109102
AA Change: C244*
SMART Domains Protein: ENSMUSP00000104730
Gene: ENSMUSG00000031758
AA Change: C244*

DomainStartEndE-ValueType
CHROMO 6 60 1.25e-17 SMART
Pfam:ECH_1 252 499 5e-33 PFAM
Pfam:ECH_2 258 501 1.6e-14 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Cdyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cdyl2 APN 8 116595189 splice site probably benign
IGL01670:Cdyl2 APN 8 116624353 missense probably damaging 1.00
IGL01964:Cdyl2 APN 8 116624029 missense probably benign 0.00
IGL02148:Cdyl2 APN 8 116589244 splice site probably benign
IGL02186:Cdyl2 APN 8 116579286 missense possibly damaging 0.78
R0449:Cdyl2 UTSW 8 116583192 missense probably damaging 1.00
R0630:Cdyl2 UTSW 8 116624035 missense probably benign 0.03
R1430:Cdyl2 UTSW 8 116579317 splice site probably benign
R1883:Cdyl2 UTSW 8 116595163 missense probably damaging 1.00
R2326:Cdyl2 UTSW 8 116623798 missense probably benign
R4194:Cdyl2 UTSW 8 116579164 splice site probably null
R4916:Cdyl2 UTSW 8 116579187 missense probably damaging 1.00
R4977:Cdyl2 UTSW 8 116575269 missense probably damaging 0.99
R5092:Cdyl2 UTSW 8 116623940 missense possibly damaging 0.50
R5727:Cdyl2 UTSW 8 116583168 missense probably damaging 1.00
R5830:Cdyl2 UTSW 8 116595084 missense probably benign 0.23
R6077:Cdyl2 UTSW 8 116589390 missense probably damaging 1.00
R6086:Cdyl2 UTSW 8 116589296 missense probably damaging 1.00
R6145:Cdyl2 UTSW 8 116594978 missense probably damaging 1.00
R6380:Cdyl2 UTSW 8 116583184 missense probably damaging 1.00
R7152:Cdyl2 UTSW 8 116624327 missense probably damaging 1.00
R7193:Cdyl2 UTSW 8 116623994 missense probably benign 0.09
R7244:Cdyl2 UTSW 8 116575260 nonsense probably null
R7394:Cdyl2 UTSW 8 116624051 missense not run
Predicted Primers PCR Primer
(F):5'- CTGCTCTAGAGTGTGTCCAC -3'
(R):5'- TAGCACAGGCCAGTTTCTC -3'

Sequencing Primer
(F):5'- AGGCGTGTTGCTAACTCAC -3'
(R):5'- AGCACAGGCCAGTTTCTCACTTAG -3'
Posted On2016-07-22