Incidental Mutation 'R5320:Rsl24d1'
ID406057
Institutional Source Beutler Lab
Gene Symbol Rsl24d1
Ensembl Gene ENSMUSG00000032215
Gene Nameribosomal L24 domain containing 1
Synonyms2410159K22Rik
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location73113426-73123333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73116416 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 292 (F292I)
Ref Sequence ENSEMBL: ENSMUSP00000134473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034738] [ENSMUST00000113505] [ENSMUST00000165177] [ENSMUST00000169399] [ENSMUST00000174203]
Predicted Effect probably benign
Transcript: ENSMUST00000034738
AA Change: F69I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034738
Gene: ENSMUSG00000032215
AA Change: F69I

DomainStartEndE-ValueType
TRASH 6 44 1.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113505
Predicted Effect probably benign
Transcript: ENSMUST00000165177
AA Change: F70I

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126553
Gene: ENSMUSG00000032215
AA Change: F70I

DomainStartEndE-ValueType
Pfam:Ribosomal_L24e 18 67 1.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169399
Predicted Effect possibly damaging
Transcript: ENSMUST00000174203
AA Change: F292I

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134473
Gene: ENSMUSG00000092310
AA Change: F292I

DomainStartEndE-ValueType
internal_repeat_1 116 173 5.47e-9 PROSPERO
internal_repeat_1 177 233 5.47e-9 PROSPERO
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein sharing a low level of sequence similarity with human ribosomal protein L24. Although this gene has been referred to as RPL24, L30, and 60S ribosomal protein L30 isolog in the sequence databases, it is distinct from the human genes officially named RPL24 (which itself has been referred to as ribosomal protein L30) and RPL30. The protein encoded by this gene localizes to the nucleolus and is thought to play a role in the biogenesis of the 60S ribosomal subunit. The precise function of this gene is currently unknown. This gene utilizes alternative polyadenylation signals and has multiple pseudogenes. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Rsl24d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03296:Rsl24d1 APN 9 73117947 critical splice donor site probably null
R1953:Rsl24d1 UTSW 9 73114614 intron probably benign
R2909:Rsl24d1 UTSW 9 73122303 missense probably damaging 0.97
R6602:Rsl24d1 UTSW 9 73113510 missense possibly damaging 0.86
R6701:Rsl24d1 UTSW 9 73114997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCTCACAGCTGCTGGAC -3'
(R):5'- AGGCAGCCAGTCTAGCATTC -3'

Sequencing Primer
(F):5'- CTGGACAGCCACTGATAGGG -3'
(R):5'- CCTTATTTATTCCTGCAGAATGTGTG -3'
Posted On2016-07-22