Incidental Mutation 'R5320:Myh8'
ID406070
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67286263 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 414 (V414I)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625] [ENSMUST00000108685]
Predicted Effect probably damaging
Transcript: ENSMUST00000019625
AA Change: V414I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: V414I

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108685
SMART Domains Protein: ENSMUSP00000104325
Gene: ENSMUSG00000055775

DomainStartEndE-ValueType
Pfam:Myosin_N 37 78 3.8e-17 PFAM
Pfam:Myosin_head 90 172 1.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139052
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCAAAGAACTTCATTTGCC -3'
(R):5'- GTGACCATCCACAGGAACATCTTC -3'

Sequencing Primer
(F):5'- GCAAAGAACTTCATTTGCCTTTTTG -3'
(R):5'- GGAACATCTTCTCATAGACAGCCTTG -3'
Posted On2016-07-22