Incidental Mutation 'R0498:Fhod1'
ID40608
Institutional Source Beutler Lab
Gene Symbol Fhod1
Ensembl Gene ENSMUSG00000014778
Gene Nameformin homology 2 domain containing 1
Synonyms
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105329163-105347953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105329856 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1101 (R1101C)
Ref Sequence ENSEMBL: ENSMUSP00000014922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000015000] [ENSMUST00000070508] [ENSMUST00000098453] [ENSMUST00000109372] [ENSMUST00000126705] [ENSMUST00000153146] [ENSMUST00000209964] [ENSMUST00000210412] [ENSMUST00000210801] [ENSMUST00000211199]
Predicted Effect probably damaging
Transcript: ENSMUST00000014922
AA Change: R1101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778
AA Change: R1101C

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000015000
SMART Domains Protein: ENSMUSP00000015000
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 171 1.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070508
SMART Domains Protein: ENSMUSP00000063248
Gene: ENSMUSG00000041679

DomainStartEndE-ValueType
LRR 42 67 7.15e-2 SMART
LRR 68 93 1.92e-2 SMART
LRR 94 119 1.23e0 SMART
LRR 120 145 1.56e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098453
SMART Domains Protein: ENSMUSP00000096052
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 3.7e-29 PFAM
low complexity region 118 133 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109372
SMART Domains Protein: ENSMUSP00000104997
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 4.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126705
SMART Domains Protein: ENSMUSP00000138226
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 100 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134837
Predicted Effect probably benign
Transcript: ENSMUST00000153146
SMART Domains Protein: ENSMUSP00000138470
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 100 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209964
Predicted Effect probably benign
Transcript: ENSMUST00000210412
Predicted Effect probably benign
Transcript: ENSMUST00000210801
Predicted Effect probably benign
Transcript: ENSMUST00000211199
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Fhod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Fhod1 APN 8 105332102 missense possibly damaging 0.66
IGL01149:Fhod1 APN 8 105347807 unclassified probably benign
IGL01325:Fhod1 APN 8 105331649 missense probably benign 0.33
IGL01470:Fhod1 APN 8 105329649 missense probably damaging 1.00
IGL01521:Fhod1 APN 8 105330423 missense probably benign 0.17
IGL01861:Fhod1 APN 8 105331176 missense probably damaging 1.00
IGL02864:Fhod1 APN 8 105337164 unclassified probably benign
IGL02951:Fhod1 APN 8 105331230 missense probably damaging 1.00
reactive UTSW 8 105336434 unclassified probably benign
treason UTSW 8 105337350 unclassified probably benign
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R1234:Fhod1 UTSW 8 105337163 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1485:Fhod1 UTSW 8 105336798 critical splice acceptor site probably null
R1585:Fhod1 UTSW 8 105337325 unclassified probably benign
R1615:Fhod1 UTSW 8 105347831 unclassified probably benign
R1778:Fhod1 UTSW 8 105329677 missense probably damaging 1.00
R1781:Fhod1 UTSW 8 105347789 unclassified probably benign
R2291:Fhod1 UTSW 8 105336964 unclassified probably benign
R2864:Fhod1 UTSW 8 105332911 missense probably null 0.97
R2865:Fhod1 UTSW 8 105332911 missense probably null 0.97
R3775:Fhod1 UTSW 8 105331638 unclassified probably benign
R4107:Fhod1 UTSW 8 105338038 unclassified probably benign
R4422:Fhod1 UTSW 8 105337351 unclassified probably benign
R4423:Fhod1 UTSW 8 105337351 unclassified probably benign
R4424:Fhod1 UTSW 8 105337351 unclassified probably benign
R4425:Fhod1 UTSW 8 105337351 unclassified probably benign
R4641:Fhod1 UTSW 8 105329592 missense probably damaging 1.00
R4724:Fhod1 UTSW 8 105337861 unclassified probably benign
R4757:Fhod1 UTSW 8 105347811 unclassified probably benign
R5004:Fhod1 UTSW 8 105336945 unclassified probably benign
R5082:Fhod1 UTSW 8 105330513 missense probably damaging 1.00
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6298:Fhod1 UTSW 8 105337148 unclassified probably benign
R6320:Fhod1 UTSW 8 105337350 unclassified probably benign
R6362:Fhod1 UTSW 8 105331641 critical splice donor site probably null
R6449:Fhod1 UTSW 8 105330237 missense probably damaging 1.00
R6736:Fhod1 UTSW 8 105337890 unclassified probably benign
R6816:Fhod1 UTSW 8 105330544 missense probably benign 0.10
R6955:Fhod1 UTSW 8 105333007 missense probably benign 0.00
R7073:Fhod1 UTSW 8 105337139 missense unknown
Predicted Primers PCR Primer
(F):5'- GCACCAGCAGGTCCATTATCTCATC -3'
(R):5'- TGCCACACACTGAGAGAGTTTGCC -3'

Sequencing Primer
(F):5'- AGGTCCATTATCTCATCTGACGTG -3'
(R):5'- ATCGGACTTGTCGGGAAC -3'
Posted On2013-05-23