Incidental Mutation 'R5321:Gm14410'
ID406098
Institutional Source Beutler Lab
Gene Symbol Gm14410
Ensembl Gene ENSMUSG00000078870
Gene Namepredicted gene 14410
Synonyms
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5321 (G1)
Quality Score96
Status Not validated
Chromosome2
Chromosomal Location177183453-177206421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 177193505 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 322 (T322I)
Ref Sequence ENSEMBL: ENSMUSP00000114668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108964] [ENSMUST00000133301]
Predicted Effect probably benign
Transcript: ENSMUST00000108964
SMART Domains Protein: ENSMUSP00000104592
Gene: ENSMUSG00000078870

DomainStartEndE-ValueType
KRAB 4 64 1.47e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133301
AA Change: T322I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114668
Gene: ENSMUSG00000078870
AA Change: T322I

DomainStartEndE-ValueType
KRAB 4 66 1.84e-13 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 9.58e-3 SMART
ZnF_C2H2 159 181 5.67e-5 SMART
ZnF_C2H2 187 209 4.01e-5 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 8.47e-4 SMART
ZnF_C2H2 271 293 1.67e-2 SMART
ZnF_C2H2 299 321 3.89e-3 SMART
ZnF_C2H2 327 349 1.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156269
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Gm14410
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1165:Gm14410 UTSW 2 177193489 nonsense probably null
R4528:Gm14410 UTSW 2 177193941 missense probably damaging 1.00
R4528:Gm14410 UTSW 2 177193943 missense probably benign 0.00
R4591:Gm14410 UTSW 2 177194027 missense possibly damaging 0.53
R6247:Gm14410 UTSW 2 177193724 missense probably damaging 0.99
R6528:Gm14410 UTSW 2 177193508 missense probably damaging 0.99
R6863:Gm14410 UTSW 2 177194067 nonsense probably null
R7302:Gm14410 UTSW 2 177193855 missense probably damaging 1.00
R7474:Gm14410 UTSW 2 177202825 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACTGCTTGCGAAGGCTTTAC -3'
(R):5'- TTGCAATAAGTGGTGACCTCC -3'

Sequencing Primer
(F):5'- GCGAAGGCTTTACCACATTG -3'
(R):5'- TGCAATAAGTGGTGACCTCCAAAAAC -3'
Posted On2016-07-22