Incidental Mutation 'R0498:Ap1m2'
List |< first << previous [record 53 of 958] next >> last >|
ID40610
Institutional Source Beutler Lab
Gene Symbol Ap1m2
Ensembl Gene ENSMUSG00000003309
Gene Nameadaptor protein complex AP-1, mu 2 subunit
SynonymsD9Ertd818e, [m]1B, mu1B
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R0498 (G1)
Quality Score82
Status Validated
Chromosome9
Chromosomal Location21294275-21312337 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 21295833 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 426 (*426W)
Ref Sequence ENSEMBL: ENSMUSP00000111093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000086374] [ENSMUST00000115433] [ENSMUST00000213407] [ENSMUST00000213762] [ENSMUST00000215619]
Predicted Effect probably null
Transcript: ENSMUST00000003397
AA Change: *424W
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309
AA Change: *424W

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086374
SMART Domains Protein: ENSMUSP00000083561
Gene: ENSMUSG00000096472

DomainStartEndE-ValueType
ANK 41 69 1.01e2 SMART
ANK 73 102 1.73e-4 SMART
ANK 106 134 8.89e1 SMART
Blast:ANK 138 166 1e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000115433
AA Change: *426W
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309
AA Change: *426W

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213483
Predicted Effect probably benign
Transcript: ENSMUST00000213762
Predicted Effect probably benign
Transcript: ENSMUST00000215619
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 1 (AP-1), which belongs to the adaptor complexes medium subunits family. This protein is capable of interacting with tyrosine-based sorting signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show small intestine crypt hyperplasia and villous dysplasia due to altered polarity and hyperproliferation of epithelial cells, exhibit spontaneous chronic colitis due to epithelial immune dysfunction, and develop a digestive disorder that causes malnutrition, growth retardation and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Ap1m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Ap1m2 APN 9 21299304 missense probably benign 0.01
IGL02320:Ap1m2 APN 9 21299324 nonsense probably null
IGL02533:Ap1m2 APN 9 21296501 missense probably damaging 1.00
IGL02806:Ap1m2 APN 9 21305683 missense probably damaging 1.00
PIT1430001:Ap1m2 UTSW 9 21298252 missense probably damaging 0.98
R0172:Ap1m2 UTSW 9 21298332 splice site probably null
R1272:Ap1m2 UTSW 9 21305710 missense possibly damaging 0.85
R1424:Ap1m2 UTSW 9 21298204 missense possibly damaging 0.95
R1747:Ap1m2 UTSW 9 21305686 missense probably damaging 1.00
R4477:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4478:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4573:Ap1m2 UTSW 9 21305758 missense probably damaging 1.00
R4702:Ap1m2 UTSW 9 21298295 missense probably benign 0.24
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R5285:Ap1m2 UTSW 9 21305637 nonsense probably null
R6131:Ap1m2 UTSW 9 21296501 missense probably damaging 1.00
R6191:Ap1m2 UTSW 9 21299305 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGCAGTTTACTGCAAGAAGGCAC -3'
(R):5'- GCTGACACTTAGCACCTCCAGATG -3'

Sequencing Primer
(F):5'- AGCAGAGTTCAGGCCCTC -3'
(R):5'- tgccatccagccacatc -3'
Posted On2013-05-23