Incidental Mutation 'R5321:Phtf1'
ID406101
Institutional Source Beutler Lab
Gene Symbol Phtf1
Ensembl Gene ENSMUSG00000058388
Gene Nameputative homeodomain transcription factor 1
SynonymsPhft
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103968110-104024598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104003511 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 606 (T606I)
Ref Sequence ENSEMBL: ENSMUSP00000088184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055425] [ENSMUST00000063717] [ENSMUST00000090685] [ENSMUST00000117150] [ENSMUST00000145727]
Predicted Effect probably benign
Transcript: ENSMUST00000055425
AA Change: T598I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058137
Gene: ENSMUSG00000058388
AA Change: T598I

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 60 8.6e-31 PFAM
Pfam:Phtf-FEM1B_bdg 57 105 5.2e-18 PFAM
low complexity region 117 128 N/A INTRINSIC
low complexity region 294 317 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
transmembrane domain 557 579 N/A INTRINSIC
transmembrane domain 594 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063717
AA Change: T651I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000066607
Gene: ENSMUSG00000058388
AA Change: T651I

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 151 9.9e-73 PFAM
low complexity region 155 163 N/A INTRINSIC
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090685
AA Change: T606I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088184
Gene: ENSMUSG00000058388
AA Change: T606I

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 8.9e-89 PFAM
low complexity region 302 325 N/A INTRINSIC
transmembrane domain 428 447 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 602 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117150
AA Change: T651I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113973
Gene: ENSMUSG00000058388
AA Change: T651I

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145727
AA Change: T651I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388
AA Change: T651I

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150090
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Phtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phtf1 APN 3 103988667 missense probably benign
IGL01139:Phtf1 APN 3 104005602 missense probably damaging 1.00
IGL01677:Phtf1 APN 3 103998783 missense probably damaging 1.00
IGL02169:Phtf1 APN 3 103997499 missense probably benign
IGL02542:Phtf1 APN 3 103993906 splice site probably benign
IGL02557:Phtf1 APN 3 103998765 missense probably damaging 1.00
IGL02697:Phtf1 APN 3 103997563 missense probably benign
IGL02807:Phtf1 APN 3 103997553 missense probably benign 0.00
R0140:Phtf1 UTSW 3 103987560 missense probably null 1.00
R0555:Phtf1 UTSW 3 104004469 missense probably damaging 1.00
R0620:Phtf1 UTSW 3 103993765 missense probably damaging 1.00
R1480:Phtf1 UTSW 3 103987434 nonsense probably null
R1799:Phtf1 UTSW 3 103996642 missense probably benign 0.01
R1804:Phtf1 UTSW 3 103987567 unclassified probably benign
R1921:Phtf1 UTSW 3 103969122 nonsense probably null
R1943:Phtf1 UTSW 3 103993882 nonsense probably null
R2006:Phtf1 UTSW 3 104004483 critical splice donor site probably null
R3729:Phtf1 UTSW 3 103985779 missense probably benign 0.00
R3731:Phtf1 UTSW 3 103985779 missense probably benign 0.00
R4051:Phtf1 UTSW 3 104005508 missense possibly damaging 0.92
R4210:Phtf1 UTSW 3 104003603 critical splice donor site probably null
R4211:Phtf1 UTSW 3 104003603 critical splice donor site probably null
R4730:Phtf1 UTSW 3 103987435 missense probably damaging 1.00
R4982:Phtf1 UTSW 3 103998708 missense probably damaging 1.00
R5314:Phtf1 UTSW 3 103999287 missense probably damaging 1.00
R5499:Phtf1 UTSW 3 103991175 missense probably benign 0.00
R6134:Phtf1 UTSW 3 104004405 missense probably damaging 0.99
R6603:Phtf1 UTSW 3 103993873 missense probably damaging 1.00
R7242:Phtf1 UTSW 3 103998696 missense probably damaging 0.99
R7311:Phtf1 UTSW 3 103997664 missense possibly damaging 0.64
R7519:Phtf1 UTSW 3 103969119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCTCTTGTCCTTTGAGG -3'
(R):5'- GTGTTACACTCATTTTAGATGCAGG -3'

Sequencing Primer
(F):5'- CCTTTGAGGAAACTGTAGATTGC -3'
(R):5'- CACTCATTTTAGATGCAGGAGAAAG -3'
Posted On2016-07-22