Incidental Mutation 'R5321:Slc15a5'
ID406108
Institutional Source Beutler Lab
Gene Symbol Slc15a5
Ensembl Gene ENSMUSG00000044378
Gene Namesolute carrier family 15, member 5
Synonyms
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location137983586-138079916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 137987438 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 496 (N496K)
Ref Sequence ENSEMBL: ENSMUSP00000129239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171804]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050132
SMART Domains Protein: ENSMUSP00000050794
Gene: ENSMUSG00000044378

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
Pfam:PTR2 167 345 1.2e-8 PFAM
transmembrane domain 375 394 N/A INTRINSIC
low complexity region 417 424 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111873
AA Change: N188K
SMART Domains Protein: ENSMUSP00000107504
Gene: ENSMUSG00000044378
AA Change: N188K

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 167 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171804
AA Change: N496K

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129239
Gene: ENSMUSG00000044378
AA Change: N496K

DomainStartEndE-ValueType
Pfam:PTR2 101 485 4.3e-23 PFAM
low complexity region 536 543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Slc15a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Slc15a5 APN 6 138043538 missense probably damaging 1.00
IGL02090:Slc15a5 APN 6 138043600 missense probably benign 0.00
R0288:Slc15a5 UTSW 6 138017916 splice site probably benign
R0355:Slc15a5 UTSW 6 138018114 splice site probably benign
R0825:Slc15a5 UTSW 6 138018089 missense possibly damaging 0.84
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1721:Slc15a5 UTSW 6 138072847 splice site probably benign
R1897:Slc15a5 UTSW 6 138079764 missense possibly damaging 0.93
R4159:Slc15a5 UTSW 6 138072940 missense possibly damaging 0.84
R4415:Slc15a5 UTSW 6 138079756 missense probably benign 0.34
R4703:Slc15a5 UTSW 6 138055645 missense probably benign 0.08
R4951:Slc15a5 UTSW 6 138073066 missense probably damaging 1.00
R4996:Slc15a5 UTSW 6 138043585 missense probably damaging 1.00
R5268:Slc15a5 UTSW 6 138079753 missense probably damaging 1.00
R5310:Slc15a5 UTSW 6 138073036 missense probably benign 0.28
R5963:Slc15a5 UTSW 6 138079693 missense probably damaging 1.00
R5988:Slc15a5 UTSW 6 138043531 missense probably benign 0.07
R7400:Slc15a5 UTSW 6 138073057 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACTCATTTGGTGTGAGAATAGG -3'
(R):5'- TGAGCTTCCTCACACTGGTAAC -3'

Sequencing Primer
(F):5'- CCATTACATTTCTGCAGGATGCTAG -3'
(R):5'- CATTACCAAGGTGCACAATGTTC -3'
Posted On2016-07-22