Incidental Mutation 'R5321:Tdrd12'
ID406109
Institutional Source Beutler Lab
Gene Symbol Tdrd12
Ensembl Gene ENSMUSG00000030491
Gene Nametudor domain containing 12
SynonymsEG434165, 2410070K17Rik, ecat8, 2410004F06Rik, G1-476-14, repro23
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location35469098-35537745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 35478094 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 945 (V945G)
Ref Sequence ENSEMBL: ENSMUSP00000141796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187190] [ENSMUST00000193633]
Predicted Effect probably damaging
Transcript: ENSMUST00000187190
AA Change: V1006G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140328
Gene: ENSMUSG00000030491
AA Change: V1006G

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 5.1e-24 PFAM
Pfam:DEAD 276 581 1.8e-6 PFAM
Pfam:TUDOR 852 973 4.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193633
AA Change: V945G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141796
Gene: ENSMUSG00000030491
AA Change: V945G

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 2.7e-24 PFAM
Pfam:DEAD 273 606 7.6e-7 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous males are infertile with small testes. Spermatogenesis is arrested predominantly at the pachytene spermatocyte stage. Retrotransposon hopping is derepressed in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Tdrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Tdrd12 APN 7 35505034 missense possibly damaging 0.95
IGL01879:Tdrd12 APN 7 35521923 missense probably damaging 1.00
IGL02026:Tdrd12 APN 7 35504233 splice site probably benign
IGL02186:Tdrd12 APN 7 35501401 missense probably damaging 0.99
PIT4131001:Tdrd12 UTSW 7 35481103 nonsense probably null
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0098:Tdrd12 UTSW 7 35475993 missense probably damaging 1.00
R0366:Tdrd12 UTSW 7 35508802 missense probably benign 0.25
R2050:Tdrd12 UTSW 7 35529247 missense probably damaging 0.98
R2851:Tdrd12 UTSW 7 35485373 missense probably damaging 1.00
R3715:Tdrd12 UTSW 7 35504980 missense probably benign 0.05
R3859:Tdrd12 UTSW 7 35493820 missense possibly damaging 0.50
R3912:Tdrd12 UTSW 7 35487713 missense probably damaging 1.00
R4656:Tdrd12 UTSW 7 35485254 missense probably damaging 1.00
R4826:Tdrd12 UTSW 7 35504157 missense probably benign 0.00
R4969:Tdrd12 UTSW 7 35487295 splice site probably null
R5202:Tdrd12 UTSW 7 35490030 missense possibly damaging 0.49
R5642:Tdrd12 UTSW 7 35511300 missense probably damaging 0.99
R5709:Tdrd12 UTSW 7 35476053 missense probably damaging 1.00
R5835:Tdrd12 UTSW 7 35529264 missense probably damaging 1.00
R6029:Tdrd12 UTSW 7 35485230 missense probably damaging 0.98
R6101:Tdrd12 UTSW 7 35481133 nonsense probably null
R6341:Tdrd12 UTSW 7 35490048 missense probably damaging 1.00
R6631:Tdrd12 UTSW 7 35485229 missense probably damaging 0.99
R6939:Tdrd12 UTSW 7 35485599 critical splice donor site probably null
R7032:Tdrd12 UTSW 7 35481046 nonsense probably null
R7058:Tdrd12 UTSW 7 35478109 missense unknown
R7096:Tdrd12 UTSW 7 35487589 missense
R7203:Tdrd12 UTSW 7 35489223 nonsense probably null
R7229:Tdrd12 UTSW 7 35480280 missense unknown
R7265:Tdrd12 UTSW 7 35487722 missense
R7284:Tdrd12 UTSW 7 35480136 splice site probably null
R7347:Tdrd12 UTSW 7 35485692 missense
Predicted Primers PCR Primer
(F):5'- CCACATGCACTGTCACCATG -3'
(R):5'- ACTGACTCAGAGAGCTGTATGGG -3'

Sequencing Primer
(F):5'- AACAAAACCCATACCAAATCCATG -3'
(R):5'- TATGGGAAGCAGAGGCATTATGTTC -3'
Posted On2016-07-22