Incidental Mutation 'R0498:Olfr874'
ID40611
Institutional Source Beutler Lab
Gene Symbol Olfr874
Ensembl Gene ENSMUSG00000063350
Gene Nameolfactory receptor 874
SynonymsMOR161-2, GA_x6K02T2PVTD-31428850-31429782
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37745106-37748594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37746254 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 40 (G40E)
Ref Sequence ENSEMBL: ENSMUSP00000150088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115004] [ENSMUST00000216982]
Predicted Effect probably damaging
Transcript: ENSMUST00000115004
AA Change: G40E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110656
Gene: ENSMUSG00000063350
AA Change: G40E

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.9e-49 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216982
AA Change: G40E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Olfr874
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr874 APN 9 37746389 missense possibly damaging 0.89
IGL02349:Olfr874 APN 9 37746206 missense probably benign 0.03
IGL02799:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R0690:Olfr874 UTSW 9 37746217 missense probably benign 0.01
R1053:Olfr874 UTSW 9 37746835 missense probably damaging 0.99
R1777:Olfr874 UTSW 9 37746311 missense possibly damaging 0.78
R1862:Olfr874 UTSW 9 37746968 missense probably benign
R1907:Olfr874 UTSW 9 37746433 missense probably benign 0.35
R4524:Olfr874 UTSW 9 37746866 missense possibly damaging 0.50
R4731:Olfr874 UTSW 9 37746535 missense probably benign 0.06
R4746:Olfr874 UTSW 9 37746157 missense probably benign 0.02
R4768:Olfr874 UTSW 9 37746881 missense probably damaging 1.00
R5130:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R5406:Olfr874 UTSW 9 37746647 missense probably benign 0.23
R5546:Olfr874 UTSW 9 37746524 missense probably benign 0.05
R5882:Olfr874 UTSW 9 37746632 missense probably benign 0.02
R5946:Olfr874 UTSW 9 37747034 missense probably damaging 0.99
R6226:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
R6705:Olfr874 UTSW 9 37746734 missense possibly damaging 0.94
R6965:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAGGCATCTCAAACGGACTAAC -3'
(R):5'- AACTGTGTCATGCACCCTGAGTG -3'

Sequencing Primer
(F):5'- tctctctctctctctctctctttc -3'
(R):5'- CACCCTGAGTGTGAGATGATG -3'
Posted On2013-05-23