Incidental Mutation 'R5321:Tpte'
ID406111
Institutional Source Beutler Lab
Gene Symbol Tpte
Ensembl Gene ENSMUSG00000031481
Gene Nametransmembrane phosphatase with tensin homology
SynonymsPten2
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22283441-22371418 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22297203 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 33 (R33*)
Ref Sequence ENSEMBL: ENSMUSP00000147872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077194] [ENSMUST00000211497] [ENSMUST00000211747]
Predicted Effect probably null
Transcript: ENSMUST00000077194
AA Change: R33*
SMART Domains Protein: ENSMUSP00000076435
Gene: ENSMUSG00000031481
AA Change: R33*

DomainStartEndE-ValueType
low complexity region 146 167 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 246 265 N/A INTRINSIC
transmembrane domain 277 299 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
Pfam:Y_phosphatase 369 511 1.4e-6 PFAM
Pfam:DSPc 384 505 7.3e-8 PFAM
PTEN_C2 529 663 3.72e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000211497
AA Change: R33*
Predicted Effect probably null
Transcript: ENSMUST00000211747
AA Change: R33*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TPIP is a member of a large class of membrane-associated phosphatases with substrate specificity for the 3-position phosphate of inositol phospholipids.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Tpte
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Tpte APN 8 22320882 missense probably benign 0.03
IGL01456:Tpte APN 8 22345052 splice site probably benign
IGL01947:Tpte APN 8 22355473 missense possibly damaging 0.88
IGL01975:Tpte APN 8 22349337 missense probably damaging 1.00
IGL02458:Tpte APN 8 22305858 missense probably benign
IGL03411:Tpte APN 8 22325537 missense possibly damaging 0.64
R0158:Tpte UTSW 8 22327739 missense possibly damaging 0.47
R0396:Tpte UTSW 8 22335608 splice site probably benign
R0611:Tpte UTSW 8 22336533 missense possibly damaging 0.68
R1481:Tpte UTSW 8 22355471 missense probably damaging 1.00
R1489:Tpte UTSW 8 22349389 critical splice donor site probably null
R1569:Tpte UTSW 8 22345031 missense probably damaging 0.98
R1632:Tpte UTSW 8 22349347 missense probably damaging 0.98
R1639:Tpte UTSW 8 22320897 missense probably benign 0.00
R2030:Tpte UTSW 8 22345885 missense probably damaging 1.00
R2057:Tpte UTSW 8 22318339 missense probably benign 0.13
R2519:Tpte UTSW 8 22333160 splice site probably benign
R2655:Tpte UTSW 8 22311278 critical splice acceptor site probably null
R2884:Tpte UTSW 8 22335423 nonsense probably null
R3033:Tpte UTSW 8 22320872 missense possibly damaging 0.84
R3734:Tpte UTSW 8 22359482 missense probably damaging 1.00
R3961:Tpte UTSW 8 22359415 missense probably damaging 0.99
R4050:Tpte UTSW 8 22365984 missense probably damaging 1.00
R4591:Tpte UTSW 8 22327775 missense probably benign 0.08
R4994:Tpte UTSW 8 22318346 missense probably benign 0.23
R5394:Tpte UTSW 8 22327790 missense probably damaging 1.00
R5588:Tpte UTSW 8 22284967 missense possibly damaging 0.95
R5590:Tpte UTSW 8 22351452 missense probably damaging 1.00
R5670:Tpte UTSW 8 22327748 missense probably damaging 1.00
R6544:Tpte UTSW 8 22315105 critical splice donor site probably null
R6596:Tpte UTSW 8 22333269 missense probably damaging 0.99
R6729:Tpte UTSW 8 22355475 missense probably damaging 1.00
R7120:Tpte UTSW 8 22327673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACAGGGCTCTCGATTTTG -3'
(R):5'- TTCTGAGACAGGGCCAGATG -3'

Sequencing Primer
(F):5'- ACAGGGCTCTCGATTTTGAATTC -3'
(R):5'- AAATTTCCCCCTGGTGATGAG -3'
Posted On2016-07-22