Incidental Mutation 'R5321:Endou'
ID406122
Institutional Source Beutler Lab
Gene Symbol Endou
Ensembl Gene ENSMUSG00000022468
Gene Nameendonuclease, polyU-specific
SynonymsTcl-30, Pp11r
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97711015-97731339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97721032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000155246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023105] [ENSMUST00000100249] [ENSMUST00000230430]
Predicted Effect probably benign
Transcript: ENSMUST00000023105
AA Change: V37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023105
Gene: ENSMUSG00000022468
AA Change: V37A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SO 127 169 1.93e-11 SMART
Pfam:XendoU 181 448 1.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100249
SMART Domains Protein: ENSMUSP00000097820
Gene: ENSMUSG00000022468

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
SO 20 62 8.61e-9 SMART
SO 85 127 1.93e-11 SMART
Pfam:XendoU 136 407 2.8e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230430
AA Change: V37A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with protease activity and is expressed in the placenta. The protein may be useful as a tumor marker. Multiple alternatively spliced transcript variants have been found for this protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal splenic B cell numbers and activation-induced B cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Endou
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0364:Endou UTSW 15 97718973 splice site probably benign
R1134:Endou UTSW 15 97713866 missense probably damaging 1.00
R1418:Endou UTSW 15 97718973 splice site probably benign
R1896:Endou UTSW 15 97712992 missense probably damaging 1.00
R2960:Endou UTSW 15 97713806 missense probably damaging 1.00
R4018:Endou UTSW 15 97718937 missense probably damaging 0.99
R4618:Endou UTSW 15 97713882 missense possibly damaging 0.67
R4754:Endou UTSW 15 97726539 missense probably damaging 0.99
R4807:Endou UTSW 15 97731232 missense probably benign 0.01
R4997:Endou UTSW 15 97719577 missense probably damaging 1.00
R5470:Endou UTSW 15 97718955 missense probably damaging 1.00
R5604:Endou UTSW 15 97720919 missense probably benign 0.00
R5764:Endou UTSW 15 97714607 missense probably damaging 1.00
R6114:Endou UTSW 15 97713876 nonsense probably null
R6404:Endou UTSW 15 97712131 missense probably damaging 1.00
R6528:Endou UTSW 15 97719629 missense probably damaging 1.00
R7089:Endou UTSW 15 97720245 missense probably benign 0.01
R7103:Endou UTSW 15 97718929 missense probably damaging 1.00
R7382:Endou UTSW 15 97718926 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGGTATTCGCACATCCCATC -3'
(R):5'- TTAAACCGTGCTTCGACAATAC -3'

Sequencing Primer
(F):5'- TATTCGCACATCCCATCCCAGC -3'
(R):5'- GTGCTTCGACAATACTTAACACCTG -3'
Posted On2016-07-22