Incidental Mutation 'R5321:Cryzl1'
ID406124
Institutional Source Beutler Lab
Gene Symbol Cryzl1
Ensembl Gene ENSMUSG00000058240
Gene Namecrystallin, zeta (quinone reductase)-like 1
Synonyms
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91689322-91728975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91707230 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 109 (Y109C)
Ref Sequence ENSEMBL: ENSMUSP00000109656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073466] [ENSMUST00000114023] [ENSMUST00000117644] [ENSMUST00000122254] [ENSMUST00000124282] [ENSMUST00000159295] [ENSMUST00000231499]
Predicted Effect probably benign
Transcript: ENSMUST00000073466
AA Change: Y109C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000073171
Gene: ENSMUSG00000058240
AA Change: Y109C

DomainStartEndE-ValueType
Pfam:ADH_N 30 142 3.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114023
AA Change: Y109C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109656
Gene: ENSMUSG00000058240
AA Change: Y109C

DomainStartEndE-ValueType
Pfam:ADH_N 30 140 2e-8 PFAM
Pfam:ADH_zinc_N 156 231 5.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117644
AA Change: Y94C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113227
Gene: ENSMUSG00000058240
AA Change: Y94C

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 141 212 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122254
SMART Domains Protein: ENSMUSP00000112734
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Blast:PKS_ER 71 150 1e-9 BLAST
SCOP:d1heta1 73 137 4e-12 SMART
low complexity region 172 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124282
AA Change: Y109C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115686
Gene: ENSMUSG00000058240
AA Change: Y109C

DomainStartEndE-ValueType
Pfam:ADH_N 30 150 1.7e-8 PFAM
Pfam:ADH_zinc_N 156 227 3.9e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141664
AA Change: Y125C
Predicted Effect unknown
Transcript: ENSMUST00000144472
AA Change: Y36C
SMART Domains Protein: ENSMUSP00000116833
Gene: ENSMUSG00000058240
AA Change: Y36C

DomainStartEndE-ValueType
Blast:PKS_ER 2 152 8e-13 BLAST
PDB:3SLK|B 2 152 3e-10 PDB
SCOP:d1heta1 24 103 1e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156242
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231499
AA Change: Y83C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232491
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has sequence similarity to zeta crystallin, also known as quinone oxidoreductase. This zeta crystallin-like protein also contains an NAD(P)H binding site. Alternatively spliced transcript variants have been observed but their full-length nature has not been completely determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Cryzl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Cryzl1 APN 16 91712251 missense possibly damaging 0.90
IGL02937:Cryzl1 APN 16 91690731 missense possibly damaging 0.62
R0360:Cryzl1 UTSW 16 91707267 missense probably benign 0.00
R0364:Cryzl1 UTSW 16 91707267 missense probably benign 0.00
R0513:Cryzl1 UTSW 16 91699287 missense possibly damaging 0.87
R0630:Cryzl1 UTSW 16 91707219 splice site probably benign
R1355:Cryzl1 UTSW 16 91692658 missense possibly damaging 0.48
R1370:Cryzl1 UTSW 16 91692658 missense possibly damaging 0.48
R1709:Cryzl1 UTSW 16 91712236 missense probably damaging 0.99
R2284:Cryzl1 UTSW 16 91694305 unclassified probably benign
R5768:Cryzl1 UTSW 16 91695354 missense probably damaging 1.00
R6468:Cryzl1 UTSW 16 91692525 unclassified probably null
R7372:Cryzl1 UTSW 16 91712197 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTGAAAGATTCTACAGCCATGAGC -3'
(R):5'- AGGGTTCTGTTCAGGGCATAC -3'

Sequencing Primer
(F):5'- GAGCAATGTTAGTAAATCTCACAGG -3'
(R):5'- AGGTCTGCTGCATGACATC -3'
Posted On2016-07-22