Incidental Mutation 'R0498:Dpp8'
ID40613
Institutional Source Beutler Lab
Gene Symbol Dpp8
Ensembl Gene ENSMUSG00000032393
Gene Namedipeptidylpeptidase 8
Synonyms2310004I03Rik, 4932434F09Rik
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65032414-65082651 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 65045795 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034960] [ENSMUST00000167773] [ENSMUST00000217434]
Predicted Effect probably benign
Transcript: ENSMUST00000034960
SMART Domains Protein: ENSMUSP00000034960
Gene: ENSMUSG00000032393

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 1e-100 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 671 860 4.8e-9 PFAM
Pfam:Peptidase_S9 676 885 6.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167773
SMART Domains Protein: ENSMUSP00000126065
Gene: ENSMUSG00000032393

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 3.3e-102 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 670 860 6.5e-9 PFAM
Pfam:Peptidase_S9 677 885 8.6e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217434
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S9B family, a small family of dipeptidyl peptidases that are able to cleave peptide substrates at a prolyl bond. The encoded protein shares similarity with dipeptidyl peptidase IV in that it is ubiquitously expressed, and hydrolyzes the same substrates. These similarities suggest that, like dipeptidyl peptidase IV, this protein may play a role in T-cell activation and immune function. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Dpp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Dpp8 APN 9 65078008 missense probably damaging 1.00
IGL00576:Dpp8 APN 9 65043829 missense probably benign 0.32
IGL01303:Dpp8 APN 9 65055012 splice site probably benign
IGL01506:Dpp8 APN 9 65063417 splice site probably benign
IGL01544:Dpp8 APN 9 65054988 missense probably benign 0.05
IGL02387:Dpp8 APN 9 65045716 missense probably damaging 1.00
IGL02567:Dpp8 APN 9 65078776 nonsense probably null
IGL02611:Dpp8 APN 9 65055793 missense probably benign 0.15
IGL02723:Dpp8 APN 9 65042267 missense possibly damaging 0.91
IGL02927:Dpp8 APN 9 65060269 missense probably benign 0.09
IGL03116:Dpp8 APN 9 65066467 missense probably damaging 0.96
IGL03135:Dpp8 APN 9 65053040 splice site probably null
IGL03356:Dpp8 APN 9 65045787 missense probably benign 0.00
IGL03050:Dpp8 UTSW 9 65054836 missense probably benign 0.00
R0594:Dpp8 UTSW 9 65036998 missense probably damaging 1.00
R0675:Dpp8 UTSW 9 65066502 splice site probably benign
R0699:Dpp8 UTSW 9 65054894 missense probably benign 0.01
R0831:Dpp8 UTSW 9 65078679 missense possibly damaging 0.56
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1512:Dpp8 UTSW 9 65063814 splice site probably benign
R1515:Dpp8 UTSW 9 65078748 missense probably benign 0.04
R1546:Dpp8 UTSW 9 65063493 missense possibly damaging 0.76
R1556:Dpp8 UTSW 9 65051479 missense probably damaging 1.00
R2027:Dpp8 UTSW 9 65078774 missense probably damaging 1.00
R2104:Dpp8 UTSW 9 65074567 synonymous probably null
R2113:Dpp8 UTSW 9 65063868 missense probably benign 0.00
R2656:Dpp8 UTSW 9 65080804 missense probably damaging 1.00
R4237:Dpp8 UTSW 9 65054923 missense probably benign
R4238:Dpp8 UTSW 9 65054923 missense probably benign
R4239:Dpp8 UTSW 9 65054923 missense probably benign
R4595:Dpp8 UTSW 9 65075803 missense probably damaging 1.00
R4614:Dpp8 UTSW 9 65066396 missense probably benign 0.00
R4946:Dpp8 UTSW 9 65055918 missense probably benign 0.00
R5338:Dpp8 UTSW 9 65063924 nonsense probably null
R5378:Dpp8 UTSW 9 65078014 missense probably damaging 1.00
R5506:Dpp8 UTSW 9 65078109 splice site probably null
R5644:Dpp8 UTSW 9 65045735 nonsense probably null
R5862:Dpp8 UTSW 9 65045722 missense probably benign 0.03
R6437:Dpp8 UTSW 9 65074578 missense probably benign 0.01
R6783:Dpp8 UTSW 9 65063562 missense possibly damaging 0.76
R6863:Dpp8 UTSW 9 65035008 missense probably damaging 0.98
R7192:Dpp8 UTSW 9 65045786 missense possibly damaging 0.70
R7461:Dpp8 UTSW 9 65053120 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTTTGCGGCCCAATTTAGTGGAAAC -3'
(R):5'- CTGACAGTCTTCCTAGAACAAGCATGG -3'

Sequencing Primer
(F):5'- CTAGTTGTCCCAATATACGAATGG -3'
(R):5'- aaccatccataacgaaatctgac -3'
Posted On2013-05-23