Incidental Mutation 'R5321:Btrc'
ID406131
Institutional Source Beutler Lab
Gene Symbol Btrc
Ensembl Gene ENSMUSG00000025217
Gene Namebeta-transducin repeat containing protein
Synonymsbeta-TrCP, Fbw1a, SCF b-TRCP, Slimb, Beta-Trcp1
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45363734-45530013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45507758 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 211 (V211M)
Ref Sequence ENSEMBL: ENSMUSP00000070728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065601] [ENSMUST00000111936] [ENSMUST00000223684] [ENSMUST00000223764] [ENSMUST00000224478]
Predicted Effect probably damaging
Transcript: ENSMUST00000065601
AA Change: V211M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070728
Gene: ENSMUSG00000025217
AA Change: V211M

DomainStartEndE-ValueType
Beta-TrCP_D 138 177 3.32e-25 SMART
FBOX 189 228 5.83e-6 SMART
WD40 292 329 7.92e-3 SMART
WD40 332 369 8.68e-9 SMART
WD40 372 409 5.31e-4 SMART
WD40 415 452 5.18e-7 SMART
WD40 455 492 3.93e-7 SMART
WD40 495 532 8.42e-7 SMART
WD40 544 581 4.62e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111936
AA Change: V175M

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107567
Gene: ENSMUSG00000025217
AA Change: V175M

DomainStartEndE-ValueType
Beta-TrCP_D 102 141 3.32e-25 SMART
FBOX 153 192 5.83e-6 SMART
WD40 256 293 7.92e-3 SMART
WD40 296 333 8.68e-9 SMART
WD40 336 373 5.31e-4 SMART
WD40 379 416 5.18e-7 SMART
WD40 419 456 3.93e-7 SMART
WD40 459 496 8.42e-7 SMART
WD40 508 545 4.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223684
Predicted Effect probably benign
Transcript: ENSMUST00000223764
Predicted Effect probably damaging
Transcript: ENSMUST00000224478
AA Change: V112M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225662
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class; in addition to an F-box, this protein contains multiple WD-40 repeats. The encoded protein mediates degradation of CD4 via its interaction with HIV-1 Vpu. It has also been shown to ubiquitinate phosphorylated NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha), targeting it for degradation and thus activating nuclear factor kappa-B. Alternatively spliced transcript variants have been described. A related pseudogene exists in chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Embryonic fibroblasts from homozygotes show an increase in polyploidy and apoptosis and decreased cell proliferation. In a second allele, homozygous mutation results in reduced male fertility and abnormal male meiosis with oligozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Btrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Btrc APN 19 45527265 missense probably damaging 0.99
IGL01691:Btrc APN 19 45512678 missense probably benign 0.00
IGL02551:Btrc APN 19 45423134 missense possibly damaging 0.83
IGL02719:Btrc APN 19 45503150 missense probably damaging 1.00
IGL02852:Btrc APN 19 45512656 nonsense probably null
IGL03128:Btrc APN 19 45513520 missense probably damaging 1.00
IGL03267:Btrc APN 19 45518823 missense probably damaging 1.00
R0145:Btrc UTSW 19 45423173 missense probably damaging 0.97
R0750:Btrc UTSW 19 45503146 missense probably damaging 1.00
R1466:Btrc UTSW 19 45513382 splice site probably benign
R1584:Btrc UTSW 19 45513382 splice site probably benign
R1772:Btrc UTSW 19 45512661 missense probably damaging 0.98
R1882:Btrc UTSW 19 45527400 missense probably damaging 1.00
R1959:Btrc UTSW 19 45527343 missense probably damaging 1.00
R1961:Btrc UTSW 19 45527343 missense probably damaging 1.00
R2483:Btrc UTSW 19 45516058 missense probably damaging 1.00
R4365:Btrc UTSW 19 45513480 missense probably damaging 1.00
R4812:Btrc UTSW 19 45423164 missense possibly damaging 0.83
R4883:Btrc UTSW 19 45456587 missense probably benign 0.09
R7203:Btrc UTSW 19 45513528 splice site probably null
R7528:Btrc UTSW 19 45503086 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTTTGAGCAAAGCTGGACC -3'
(R):5'- TACAGACGATGCGCAGTGAC -3'

Sequencing Primer
(F):5'- AAAGCTGGACCACGCTG -3'
(R):5'- TGGCTCCTGACACTTGGC -3'
Posted On2016-07-22