Incidental Mutation 'R0498:Cacna1g'
ID40619
Institutional Source Beutler Lab
Gene Symbol Cacna1g
Ensembl Gene ENSMUSG00000020866
Gene Namecalcium channel, voltage-dependent, T type, alpha 1G subunit
Synonymsa1G, Cav3.1d
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.786) question?
Stock #R0498 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94408391-94474198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94459859 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 387 (I387V)
Ref Sequence ENSEMBL: ENSMUSP00000103419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021234] [ENSMUST00000100561] [ENSMUST00000103166] [ENSMUST00000107785] [ENSMUST00000107786] [ENSMUST00000107788] [ENSMUST00000107789] [ENSMUST00000107790] [ENSMUST00000107791] [ENSMUST00000107792] [ENSMUST00000107793]
Predicted Effect probably damaging
Transcript: ENSMUST00000021234
AA Change: I387V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021234
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 9.2e-66 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 7.9e-46 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 3e-55 PFAM
coiled coil region 1519 1559 N/A INTRINSIC
low complexity region 1562 1573 N/A INTRINSIC
Pfam:Ion_trans 1630 1835 3e-49 PFAM
Pfam:PKD_channel 1688 1842 7.8e-11 PFAM
low complexity region 2180 2211 N/A INTRINSIC
low complexity region 2230 2246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100561
AA Change: I387V

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098127
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
coiled coil region 1542 1582 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
Pfam:Ion_trans 1653 1858 6.2e-49 PFAM
Pfam:PKD_channel 1711 1865 1.4e-10 PFAM
low complexity region 2203 2234 N/A INTRINSIC
low complexity region 2253 2269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103166
AA Change: I387V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099455
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
SCOP:d1g2qa_ 1545 1589 6e-3 SMART
Pfam:Ion_trans 1646 1851 6.2e-49 PFAM
Pfam:PKD_channel 1704 1858 1.4e-10 PFAM
low complexity region 2196 2227 N/A INTRINSIC
low complexity region 2246 2262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107785
AA Change: I387V

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103414
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.5e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.7e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 5.8e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2027 2042 N/A INTRINSIC
low complexity region 2084 2115 N/A INTRINSIC
low complexity region 2134 2150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107786
SMART Domains Protein: ENSMUSP00000103415
Gene: ENSMUSG00000020866

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 383 4e-60 PFAM
low complexity region 466 490 N/A INTRINSIC
low complexity region 518 530 N/A INTRINSIC
Pfam:Ion_trans 760 946 1.6e-45 PFAM
low complexity region 1023 1034 N/A INTRINSIC
low complexity region 1046 1073 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
Pfam:Ion_trans 1273 1497 5.9e-55 PFAM
SCOP:d1g2qa_ 1505 1549 6e-3 SMART
Pfam:Ion_trans 1606 1811 6e-49 PFAM
Pfam:PKD_channel 1664 1818 1.4e-10 PFAM
low complexity region 2156 2187 N/A INTRINSIC
low complexity region 2206 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107788
AA Change: I387V

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103417
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1574 N/A INTRINSIC
Pfam:Ion_trans 1628 1833 6.1e-49 PFAM
Pfam:PKD_channel 1686 1840 1.4e-10 PFAM
low complexity region 2178 2209 N/A INTRINSIC
low complexity region 2228 2244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107789
AA Change: I387V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103418
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 80 406 1.6e-76 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 742 972 3.4e-56 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1276 1549 1.5e-61 PFAM
low complexity region 1578 1589 N/A INTRINSIC
Pfam:Ion_trans 1611 1863 2.1e-56 PFAM
Pfam:PKD_channel 1703 1858 3.4e-9 PFAM
low complexity region 2289 2320 N/A INTRINSIC
low complexity region 2339 2355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107790
AA Change: I387V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103419
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
SCOP:d1g2qa_ 1522 1566 6e-3 SMART
Pfam:Ion_trans 1623 1828 6.1e-49 PFAM
Pfam:PKD_channel 1681 1835 1.4e-10 PFAM
low complexity region 2173 2204 N/A INTRINSIC
low complexity region 2223 2239 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107791
AA Change: I387V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103420
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 6e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2162 2193 N/A INTRINSIC
low complexity region 2212 2228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107792
AA Change: I387V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103421
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.9e-55 PFAM
coiled coil region 1519 1551 N/A INTRINSIC
Pfam:Ion_trans 1605 1810 6e-49 PFAM
Pfam:PKD_channel 1663 1817 1.4e-10 PFAM
low complexity region 2155 2186 N/A INTRINSIC
low complexity region 2205 2221 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107793
AA Change: I387V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103422
Gene: ENSMUSG00000020866
AA Change: I387V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1581 N/A INTRINSIC
Pfam:Ion_trans 1635 1840 6.1e-49 PFAM
Pfam:PKD_channel 1693 1847 1.4e-10 PFAM
low complexity region 2185 2216 N/A INTRINSIC
low complexity region 2235 2251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152811
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygote null mice display disrupted sleeping patterns, altered amounts of activity, abnormal action potentials in the brain, prolonged electrical conductance in the heart, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Cacna1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Cacna1g APN 11 94433912 missense probably benign 0.16
IGL01382:Cacna1g APN 11 94465858 missense probably damaging 1.00
IGL01694:Cacna1g APN 11 94429112 missense probably damaging 1.00
IGL01866:Cacna1g APN 11 94457111 missense probably damaging 0.99
IGL02341:Cacna1g APN 11 94462152 missense probably damaging 1.00
IGL02506:Cacna1g APN 11 94429129 missense probably damaging 0.99
IGL02706:Cacna1g APN 11 94456992 missense probably damaging 1.00
IGL02879:Cacna1g APN 11 94409605 missense probably benign 0.12
IGL03366:Cacna1g APN 11 94457151 missense probably damaging 1.00
ANU23:Cacna1g UTSW 11 94466228 critical splice acceptor site probably benign
IGL03134:Cacna1g UTSW 11 94459825 missense probably damaging 1.00
R0092:Cacna1g UTSW 11 94457264 missense probably damaging 1.00
R0123:Cacna1g UTSW 11 94409476 missense probably damaging 1.00
R0178:Cacna1g UTSW 11 94463483 missense probably damaging 1.00
R0375:Cacna1g UTSW 11 94411054 missense possibly damaging 0.79
R0389:Cacna1g UTSW 11 94459697 missense probably damaging 1.00
R0433:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R0458:Cacna1g UTSW 11 94409440 missense probably damaging 0.96
R0629:Cacna1g UTSW 11 94409543 missense possibly damaging 0.93
R0800:Cacna1g UTSW 11 94426439 missense probably damaging 1.00
R1341:Cacna1g UTSW 11 94433756 missense probably damaging 0.99
R1457:Cacna1g UTSW 11 94459555 missense possibly damaging 0.76
R1523:Cacna1g UTSW 11 94442729 critical splice donor site probably null
R1532:Cacna1g UTSW 11 94443331 missense probably damaging 1.00
R1540:Cacna1g UTSW 11 94457039 missense probably damaging 1.00
R1652:Cacna1g UTSW 11 94427404 missense probably damaging 1.00
R1688:Cacna1g UTSW 11 94425953 missense possibly damaging 0.70
R1750:Cacna1g UTSW 11 94443292 missense probably damaging 1.00
R1751:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1767:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1847:Cacna1g UTSW 11 94466181 missense probably damaging 1.00
R1924:Cacna1g UTSW 11 94444054 missense possibly damaging 0.93
R1973:Cacna1g UTSW 11 94459777 missense possibly damaging 0.86
R2050:Cacna1g UTSW 11 94409474 missense probably damaging 1.00
R2261:Cacna1g UTSW 11 94457135 missense probably benign 0.42
R2273:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2274:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2275:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2376:Cacna1g UTSW 11 94465908 missense probably damaging 0.99
R3686:Cacna1g UTSW 11 94459090 splice site probably null
R3809:Cacna1g UTSW 11 94416096 missense probably damaging 1.00
R3875:Cacna1g UTSW 11 94437923 missense probably damaging 0.98
R4133:Cacna1g UTSW 11 94432544 missense probably damaging 1.00
R4642:Cacna1g UTSW 11 94418094 missense probably damaging 1.00
R4732:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4733:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4773:Cacna1g UTSW 11 94411472 missense possibly damaging 0.78
R4798:Cacna1g UTSW 11 94433847 missense probably damaging 1.00
R4839:Cacna1g UTSW 11 94459607 missense probably benign 0.16
R4900:Cacna1g UTSW 11 94459351 missense possibly damaging 0.78
R4927:Cacna1g UTSW 11 94429147 missense probably damaging 1.00
R4930:Cacna1g UTSW 11 94444073 missense probably damaging 1.00
R5050:Cacna1g UTSW 11 94459715 missense probably damaging 1.00
R5117:Cacna1g UTSW 11 94432503 missense probably damaging 1.00
R5186:Cacna1g UTSW 11 94442848 missense probably damaging 1.00
R5364:Cacna1g UTSW 11 94416858 missense probably benign 0.29
R5512:Cacna1g UTSW 11 94444142 missense probably damaging 1.00
R5564:Cacna1g UTSW 11 94430486 missense probably damaging 1.00
R5603:Cacna1g UTSW 11 94439752 missense possibly damaging 0.76
R5682:Cacna1g UTSW 11 94459114 missense probably damaging 1.00
R5818:Cacna1g UTSW 11 94418120 missense probably damaging 1.00
R5828:Cacna1g UTSW 11 94457154 missense probably damaging 1.00
R5882:Cacna1g UTSW 11 94459819 missense probably damaging 1.00
R5884:Cacna1g UTSW 11 94437867 missense probably damaging 1.00
R6075:Cacna1g UTSW 11 94416665 missense probably damaging 1.00
R6112:Cacna1g UTSW 11 94409246 missense probably damaging 0.98
R6122:Cacna1g UTSW 11 94430171 missense probably benign 0.11
R6145:Cacna1g UTSW 11 94462261 missense probably damaging 1.00
R6362:Cacna1g UTSW 11 94439707 critical splice donor site probably null
R6415:Cacna1g UTSW 11 94463417 missense probably damaging 1.00
R6468:Cacna1g UTSW 11 94439722 missense probably damaging 1.00
R6648:Cacna1g UTSW 11 94432569 missense probably damaging 1.00
R6746:Cacna1g UTSW 11 94409427 nonsense probably null
R6764:Cacna1g UTSW 11 94413188 missense possibly damaging 0.95
R6782:Cacna1g UTSW 11 94459550 missense probably damaging 1.00
R6888:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R7148:Cacna1g UTSW 11 94465930 missense probably benign 0.32
R7181:Cacna1g UTSW 11 94415865 missense probably benign 0.21
R7183:Cacna1g UTSW 11 94439737 missense probably benign 0.04
R7193:Cacna1g UTSW 11 94409231 missense possibly damaging 0.60
R7237:Cacna1g UTSW 11 94437879 missense probably benign 0.21
R7254:Cacna1g UTSW 11 94432567 nonsense probably null
R7312:Cacna1g UTSW 11 94432557 missense probably damaging 1.00
X0001:Cacna1g UTSW 11 94409645 missense possibly damaging 0.90
X0019:Cacna1g UTSW 11 94459253 missense probably damaging 0.97
X0065:Cacna1g UTSW 11 94462425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGTGGCAGTCAGCATGGTAG -3'
(R):5'- TATCACCAGCAGTAGTGGGCTAGG -3'

Sequencing Primer
(F):5'- gtggtagtggtgatggtgg -3'
(R):5'- GCCTGAGCTGTTGCAAAC -3'
Posted On2013-05-23