Mutagenetix > Incidental Mutation

Incidental Mutation 'R0498:Kalrn'

40632

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

E530005C20Rik, LOC224126, Hapip, 2210407G14Rik

MMRRC Submission

038694-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.920) question?

Stock #

R0498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33789443-34393647 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33875261 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 104 (D104N)

Ref Sequence

ENSEMBL: ENSMUSP00000110624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114961] [ENSMUST00000114963] [ENSMUST00000114964] [ENSMUST00000114966] [ENSMUST00000114973] [ENSMUST00000232157]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000076810
AA Change: D1773N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: D1773N

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114963
AA Change: D173N

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110614
Gene: ENSMUSG00000061751
AA Change: D173N

Domain	Start	End	E-Value	Type
SH3	22	83	1.23e-7	SMART
RhoGEF	273	443	1.47e-52	SMART
PH	463	568	9.87e-4	SMART
SH3	664	725	2.78e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114964
AA Change: D104N

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110615
Gene: ENSMUSG00000061751
AA Change: D104N

Domain	Start	End	E-Value	Type
RhoGEF	204	374	1.47e-52	SMART
PH	394	499	9.87e-4	SMART
SH3	595	656	2.78e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114966
AA Change: D104N

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000110617
Gene: ENSMUSG00000061751
AA Change: D104N

Domain	Start	End	E-Value	Type
RhoGEF	235	405	1.47e-52	SMART
PH	425	530	9.87e-4	SMART
SH3	626	687	2.78e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114973
AA Change: D104N

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: D104N

Domain	Start	End	E-Value	Type
RhoGEF	235	405	1.47e-52	SMART
PH	425	530	9.87e-4	SMART
SH3	626	687	2.78e-2	SMART
IGc2	786	858	4.28e-12	SMART
FN3	872	954	3.07e-11	SMART
S_TKc	987	1241	1.28e-71	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: D1768N

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: D1768N

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000232157
AA Change: D104N

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0870

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.4%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,642,718 (GRCm39)	D220V	probably benign	Het
Adgrf2	A	G	17: 43,025,206 (GRCm39)		probably benign	Het
Aldh18a1	A	G	19: 40,562,716 (GRCm39)	V219A	probably benign	Het
Anapc10	A	G	8: 80,501,610 (GRCm39)	D126G	probably benign	Het
Ap1m2	T	C	9: 21,207,129 (GRCm39)	*426W	probably null	Het
Arhgap21	A	G	2: 20,867,928 (GRCm39)	I865T	probably damaging	Het
Armc8	A	G	9: 99,379,345 (GRCm39)	V527A	probably damaging	Het
Asic5	A	T	3: 81,913,778 (GRCm39)		probably benign	Het
Baz2b	A	C	2: 59,732,340 (GRCm39)		probably benign	Het
Bpifa5	T	C	2: 154,009,169 (GRCm39)	V237A	probably damaging	Het
Brip1	T	A	11: 86,088,745 (GRCm39)	K52I	possibly damaging	Het
Cacna1g	T	C	11: 94,350,685 (GRCm39)	I387V	probably damaging	Het
Cbr4	A	G	8: 61,948,107 (GRCm39)	I135V	probably benign	Het
Ccdc66	C	T	14: 27,222,197 (GRCm39)		probably null	Het
Cubn	G	A	2: 13,449,078 (GRCm39)	T999M	probably damaging	Het
Dnai3	G	T	3: 145,787,119 (GRCm39)	D305E	possibly damaging	Het
Dpp8	C	T	9: 64,953,077 (GRCm39)		probably benign	Het
Dsg1b	T	C	18: 20,542,390 (GRCm39)	S966P	possibly damaging	Het
Erp27	T	C	6: 136,896,862 (GRCm39)		probably benign	Het
Fat4	A	T	3: 39,034,786 (GRCm39)	I2813L	probably benign	Het
Fhod1	G	A	8: 106,056,488 (GRCm39)	R1101C	probably damaging	Het
Hoxc9	T	C	15: 102,892,359 (GRCm39)	S191P	probably damaging	Het
Izumo4	T	C	10: 80,540,030 (GRCm39)		probably null	Het
Kank4	A	T	4: 98,667,873 (GRCm39)	D191E	probably benign	Het
Kbtbd11	A	G	8: 15,077,605 (GRCm39)	E68G	probably benign	Het
Kdr	C	T	5: 76,119,798 (GRCm39)	V654I	probably benign	Het
Klra1	A	T	6: 130,349,782 (GRCm39)		probably null	Het
Kmt2e	T	A	5: 23,683,970 (GRCm39)	Y373*	probably null	Het
Lepr	A	T	4: 101,602,889 (GRCm39)	M226L	probably benign	Het
Lrp1b	T	A	2: 41,348,417 (GRCm39)	I800F	probably benign	Het
Lta4h	T	C	10: 93,307,833 (GRCm39)		probably benign	Het
Map3k7	T	C	4: 31,974,814 (GRCm39)		probably benign	Het
Map4k4	G	A	1: 40,029,338 (GRCm39)	R371Q	probably benign	Het
Mgat4f	A	G	1: 134,318,610 (GRCm39)	I461V	possibly damaging	Het
Mme	A	G	3: 63,253,487 (GRCm39)	I444V	probably damaging	Het
Mms19	C	T	19: 41,938,212 (GRCm39)	R582Q	possibly damaging	Het
Mtss1	A	G	15: 58,817,286 (GRCm39)	S502P	probably damaging	Het
Myo3a	G	T	2: 22,467,441 (GRCm39)	A232S	possibly damaging	Het
Nwd2	G	T	5: 63,963,686 (GRCm39)	W1090L	probably damaging	Het
Or4k15	A	C	14: 50,364,750 (GRCm39)	T239P	probably damaging	Het
Or8b12	G	A	9: 37,657,550 (GRCm39)	G40E	probably damaging	Het
Pcm1	G	A	8: 41,746,806 (GRCm39)	S1335N	probably benign	Het
Pdzph1	A	G	17: 59,280,825 (GRCm39)	F486L	probably benign	Het
Piezo2	T	C	18: 63,235,245 (GRCm39)	K552R	possibly damaging	Het
Plekhs1	T	A	19: 56,469,536 (GRCm39)		probably null	Het
Pprc1	C	T	19: 46,060,007 (GRCm39)	Q1514*	probably null	Het
Ralgapa1	T	C	12: 55,736,576 (GRCm39)	T1831A	possibly damaging	Het
Rnpep	G	T	1: 135,193,090 (GRCm39)	D455E	probably damaging	Het
Rpgrip1	T	A	14: 52,368,771 (GRCm39)		probably benign	Het
Saxo1	A	T	4: 86,397,133 (GRCm39)	M135K	possibly damaging	Het
Serpina12	T	C	12: 104,002,048 (GRCm39)	T223A	probably damaging	Het
Serpinb3a	A	G	1: 106,974,880 (GRCm39)	F218L	probably damaging	Het
Serpinb9f	T	G	13: 33,509,990 (GRCm39)		probably benign	Het
Spata33	A	G	8: 123,948,662 (GRCm39)	D98G	probably benign	Het
Stard13	T	A	5: 150,975,942 (GRCm39)	Y742F	probably damaging	Het
Tecta	A	G	9: 42,288,910 (GRCm39)	Y552H	probably damaging	Het
Tie1	A	T	4: 118,336,358 (GRCm39)		probably benign	Het
Tmem161a	A	G	8: 70,633,623 (GRCm39)	T254A	probably benign	Het
Tmem30a	G	T	9: 79,681,376 (GRCm39)	Y264*	probably null	Het
Tmem87a	A	T	2: 120,224,946 (GRCm39)	I105K	probably benign	Het
Tnrc6b	A	T	15: 80,742,920 (GRCm39)	D51V	probably damaging	Het
Trgc3	T	A	13: 19,445,262 (GRCm39)	M70K	probably damaging	Het
Trpc4	T	C	3: 54,198,632 (GRCm39)	F519L	probably damaging	Het
Ttn	T	C	2: 76,539,925 (GRCm39)	T26027A	probably damaging	Het
Vmn1r198	A	C	13: 22,539,144 (GRCm39)	H121P	probably damaging	Het
Vps33a	A	G	5: 123,709,024 (GRCm39)	F64L	probably benign	Het
Zfp1008	T	C	13: 62,755,201 (GRCm39)	N39S	probably damaging	Het
Zfp994	A	T	17: 22,419,882 (GRCm39)	C356S	probably damaging	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	33,996,092 (GRCm39)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,082,999 (GRCm39)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,055,700 (GRCm39)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,114,531 (GRCm39)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,018,882 (GRCm39)	splice site	probably null
IGL02059:Kalrn	APN	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,040,592 (GRCm39)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,130,897 (GRCm39)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,152,594 (GRCm39)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,181,216 (GRCm39)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,334,329 (GRCm39)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,040,484 (GRCm39)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,212,420 (GRCm39)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,040,500 (GRCm39)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,134,562 (GRCm39)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,205,667 (GRCm39)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,134,546 (GRCm39)	missense	probably damaging	0.99
breeze	UTSW	16	33,834,045 (GRCm39)	missense
ethereal	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
Feather	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
Hidden	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
Soulful	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,018,884 (GRCm39)	splice site	probably benign
R0043:Kalrn	UTSW	16	33,875,276 (GRCm39)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,177,541 (GRCm39)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	33,851,960 (GRCm39)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	33,870,306 (GRCm39)	intron	probably benign
R0183:Kalrn	UTSW	16	33,991,749 (GRCm39)	splice site	probably null
R0422:Kalrn	UTSW	16	34,134,643 (GRCm39)	missense	probably damaging	0.99
R0614:Kalrn	UTSW	16	33,814,040 (GRCm39)	splice site	probably benign
R0656:Kalrn	UTSW	16	33,852,837 (GRCm39)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	33,936,778 (GRCm39)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	33,830,951 (GRCm39)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	33,855,924 (GRCm39)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	33,870,289 (GRCm39)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,205,760 (GRCm39)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	33,836,868 (GRCm39)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,809,173 (GRCm39)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,033,190 (GRCm39)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,796,124 (GRCm39)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	33,994,857 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,134,648 (GRCm39)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	33,830,918 (GRCm39)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,181,320 (GRCm39)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,033,243 (GRCm39)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,114,585 (GRCm39)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,177,331 (GRCm39)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,796,293 (GRCm39)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,797,894 (GRCm39)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	33,848,415 (GRCm39)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,010,106 (GRCm39)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,072,680 (GRCm39)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,152,513 (GRCm39)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,152,600 (GRCm39)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,128,094 (GRCm39)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	33,829,632 (GRCm39)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	33,996,632 (GRCm39)	splice site	probably null
R2404:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,130,865 (GRCm39)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,032,642 (GRCm39)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,177,685 (GRCm39)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,212,400 (GRCm39)	splice site	probably null
R3788:Kalrn	UTSW	16	34,040,610 (GRCm39)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	33,860,259 (GRCm39)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,024,226 (GRCm39)	splice site	probably null
R3934:Kalrn	UTSW	16	34,130,901 (GRCm39)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,055,761 (GRCm39)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,807,578 (GRCm39)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,212,412 (GRCm39)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,055,637 (GRCm39)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,334,296 (GRCm39)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	33,849,075 (GRCm39)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	33,996,761 (GRCm39)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,018,857 (GRCm39)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,177,339 (GRCm39)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,334,389 (GRCm39)	unclassified	probably benign
R4888:Kalrn	UTSW	16	33,991,700 (GRCm39)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,177,785 (GRCm39)	splice site	probably null
R5030:Kalrn	UTSW	16	33,796,112 (GRCm39)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,134,722 (GRCm39)	nonsense	probably null
R5117:Kalrn	UTSW	16	33,853,971 (GRCm39)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,083,023 (GRCm39)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	33,873,992 (GRCm39)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	33,996,150 (GRCm39)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	33,860,304 (GRCm39)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	33,834,454 (GRCm39)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	33,836,949 (GRCm39)	missense	probably benign
R5716:Kalrn	UTSW	16	33,807,546 (GRCm39)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,796,190 (GRCm39)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,032,619 (GRCm39)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,807,461 (GRCm39)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,064,203 (GRCm39)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,177,713 (GRCm39)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	33,830,950 (GRCm39)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,181,255 (GRCm39)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,805,561 (GRCm39)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,033,255 (GRCm39)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,177,481 (GRCm39)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	33,874,009 (GRCm39)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	33,875,441 (GRCm39)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,796,361 (GRCm39)	missense	probably benign
R6397:Kalrn	UTSW	16	33,813,355 (GRCm39)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,152,534 (GRCm39)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,025,672 (GRCm39)	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34,181,354 (GRCm39)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,003,117 (GRCm39)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,038,293 (GRCm39)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,796,073 (GRCm39)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,040,506 (GRCm39)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,177,418 (GRCm39)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,038,261 (GRCm39)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,076,597 (GRCm39)	missense	unknown
R7154:Kalrn	UTSW	16	34,032,527 (GRCm39)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	33,983,447 (GRCm39)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	33,996,792 (GRCm39)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	33,996,131 (GRCm39)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,076,603 (GRCm39)	missense	unknown
R7563:Kalrn	UTSW	16	34,212,464 (GRCm39)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,134,582 (GRCm39)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,810,161 (GRCm39)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,809,217 (GRCm39)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	33,849,122 (GRCm39)	missense	probably benign
R8080:Kalrn	UTSW	16	33,796,038 (GRCm39)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	33,875,414 (GRCm39)	missense	probably benign
R8239:Kalrn	UTSW	16	33,870,153 (GRCm39)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	33,855,431 (GRCm39)	nonsense	probably null
R8294:Kalrn	UTSW	16	33,853,954 (GRCm39)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,181,305 (GRCm39)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	33,854,884 (GRCm39)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,803,225 (GRCm39)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,018,830 (GRCm39)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,038,305 (GRCm39)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,814,025 (GRCm39)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,047,496 (GRCm39)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	33,854,854 (GRCm39)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,181,371 (GRCm39)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	33,834,045 (GRCm39)	missense
R9424:Kalrn	UTSW	16	33,809,188 (GRCm39)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	33,916,249 (GRCm39)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,805,600 (GRCm39)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	33,849,197 (GRCm39)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,032,583 (GRCm39)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	33,860,303 (GRCm39)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	33,855,876 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCAAAACCCTTGGTTGCACTC -3'
(R):5'- CTCCAGTGAGAATGGAGGCAAATCC -3'

Sequencing Primer
(F):5'- GCCTCTAGTTTCCAGAGTGACAG -3'
(R):5'- AGGCAAATCCGAGTCCGTG -3'

Posted On

2013-05-23