Incidental Mutation 'R0498:Pprc1'
ID40640
Institutional Source Beutler Lab
Gene Symbol Pprc1
Ensembl Gene ENSMUSG00000055491
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator-related 1
Synonyms
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46044886-46072915 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 46071568 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1514 (Q1514*)
Ref Sequence ENSEMBL: ENSMUSP00000107530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062322] [ENSMUST00000099392] [ENSMUST00000111899] [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
Predicted Effect probably null
Transcript: ENSMUST00000062322
AA Change: Q1516*
SMART Domains Protein: ENSMUSP00000079389
Gene: ENSMUSG00000055491
AA Change: Q1516*

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 214 240 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
low complexity region 516 525 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 732 739 N/A INTRINSIC
low complexity region 826 887 N/A INTRINSIC
low complexity region 915 925 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1020 1033 N/A INTRINSIC
low complexity region 1224 1240 N/A INTRINSIC
low complexity region 1397 1446 N/A INTRINSIC
low complexity region 1453 1504 N/A INTRINSIC
RRM 1526 1597 3.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099392
SMART Domains Protein: ENSMUSP00000096990
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 210 236 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
low complexity region 512 521 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 728 735 N/A INTRINSIC
low complexity region 822 883 N/A INTRINSIC
low complexity region 911 921 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 975 987 N/A INTRINSIC
low complexity region 1016 1029 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111899
AA Change: Q1514*
SMART Domains Protein: ENSMUSP00000107530
Gene: ENSMUSG00000055491
AA Change: Q1514*

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 213 239 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 731 738 N/A INTRINSIC
low complexity region 825 886 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 938 959 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
low complexity region 1019 1032 N/A INTRINSIC
low complexity region 1222 1238 N/A INTRINSIC
low complexity region 1395 1444 N/A INTRINSIC
low complexity region 1451 1502 N/A INTRINSIC
RRM 1524 1595 3.36e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153111
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to PPAR-gamma coactivator 1 (PPARGC1/PGC-1), a protein that can activate mitochondrial biogenesis in part through a direct interaction with nuclear respiratory factor 1 (NRF1). This protein has been shown to interact with NRF1. It is thought to be a functional relative of PPAR-gamma coactivator 1 that activates mitochondrial biogenesis through NRF1 in response to proliferative signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit letahlity post-implantation with delayed hatching and disorganized embryo tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Pprc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pprc1 APN 19 46062648 missense possibly damaging 0.93
IGL00825:Pprc1 APN 19 46071406 unclassified probably benign
IGL01445:Pprc1 APN 19 46065232 unclassified probably benign
IGL01449:Pprc1 APN 19 46065232 unclassified probably benign
IGL01475:Pprc1 APN 19 46071529 missense probably benign 0.03
IGL01750:Pprc1 APN 19 46071829 unclassified probably benign
IGL01779:Pprc1 APN 19 46062202 missense probably damaging 1.00
IGL01943:Pprc1 APN 19 46064544 unclassified probably benign
IGL02031:Pprc1 APN 19 46072343 unclassified probably benign
IGL02145:Pprc1 APN 19 46064890 unclassified probably benign
IGL02206:Pprc1 APN 19 46071751 missense probably damaging 0.98
IGL02439:Pprc1 APN 19 46072319 missense possibly damaging 0.94
IGL02675:Pprc1 APN 19 46063507 missense probably damaging 1.00
IGL03185:Pprc1 APN 19 46069747 intron probably benign
IGL03325:Pprc1 APN 19 46061509 missense possibly damaging 0.86
R0125:Pprc1 UTSW 19 46069512 intron probably benign
R0388:Pprc1 UTSW 19 46062775 missense possibly damaging 0.85
R1129:Pprc1 UTSW 19 46063806 missense probably benign 0.35
R1439:Pprc1 UTSW 19 46063736 missense possibly damaging 0.94
R1536:Pprc1 UTSW 19 46071526 unclassified probably benign
R4551:Pprc1 UTSW 19 46067225 unclassified probably benign
R4698:Pprc1 UTSW 19 46069195 intron probably benign
R4822:Pprc1 UTSW 19 46071356 unclassified probably benign
R4909:Pprc1 UTSW 19 46064319 missense probably damaging 0.99
R4931:Pprc1 UTSW 19 46071316 unclassified probably benign
R5132:Pprc1 UTSW 19 46072682 unclassified probably benign
R5157:Pprc1 UTSW 19 46064758 unclassified probably benign
R5834:Pprc1 UTSW 19 46065220 unclassified probably benign
R5938:Pprc1 UTSW 19 46071316 unclassified probably benign
R5947:Pprc1 UTSW 19 46063672 missense possibly damaging 0.85
R5975:Pprc1 UTSW 19 46065370 unclassified probably benign
R6009:Pprc1 UTSW 19 46071732 missense probably damaging 1.00
R6259:Pprc1 UTSW 19 46064410 missense probably damaging 0.97
R6954:Pprc1 UTSW 19 46064433 missense probably damaging 0.96
R7287:Pprc1 UTSW 19 46071354 missense unknown
R7355:Pprc1 UTSW 19 46065346 missense unknown
R7527:Pprc1 UTSW 19 46069365 missense not run
Predicted Primers PCR Primer
(F):5'- TCATCGTGCAGTTCCAGAAGCC -3'
(R):5'- AGAACCTCTGTTTCAGCTCCGACC -3'

Sequencing Primer
(F):5'- AGTTCCAGAAGCCGGTCTC -3'
(R):5'- AGCTCCGACCGAGTCATTC -3'
Posted On2013-05-23