Incidental Mutation 'R0025:Mark2'
ID40837
Institutional Source Beutler Lab
Gene Symbol Mark2
Ensembl Gene ENSMUSG00000024969
Gene NameMAP/microtubule affinity regulating kinase 2
SynonymsEmk, Par-1
MMRRC Submission 038320-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R0025 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7275396-7341860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7285922 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 160 (D160G)
Ref Sequence ENSEMBL: ENSMUSP00000129894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025921] [ENSMUST00000032557] [ENSMUST00000051711] [ENSMUST00000164129] [ENSMUST00000164205] [ENSMUST00000165286] [ENSMUST00000165965] [ENSMUST00000165989] [ENSMUST00000166461] [ENSMUST00000167767] [ENSMUST00000168324] [ENSMUST00000168872] [ENSMUST00000169541] [ENSMUST00000171352] [ENSMUST00000171393]
Predicted Effect probably damaging
Transcript: ENSMUST00000025921
AA Change: D160G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025921
Gene: ENSMUSG00000024969
AA Change: D160G

DomainStartEndE-ValueType
S_TKc 20 271 1.59e-108 SMART
UBA 292 329 7.69e-7 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
Pfam:KA1 697 743 2.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032557
AA Change: D193G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032557
Gene: ENSMUSG00000024969
AA Change: D193G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 685 731 5.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051711
AA Change: D193G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108969
Gene: ENSMUSG00000024969
AA Change: D193G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 730 776 6.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163345
SMART Domains Protein: ENSMUSP00000125944
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164129
Predicted Effect probably damaging
Transcript: ENSMUST00000164205
AA Change: D193G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127827
Gene: ENSMUSG00000024969
AA Change: D193G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 676 722 5.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165286
AA Change: D193G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126468
Gene: ENSMUSG00000024969
AA Change: D193G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 670 716 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165881
SMART Domains Protein: ENSMUSP00000126753
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165965
AA Change: D193G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131684
Gene: ENSMUSG00000024969
AA Change: D193G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165989
SMART Domains Protein: ENSMUSP00000129924
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 53 89 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166461
SMART Domains Protein: ENSMUSP00000128549
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Pfam:KA1 261 307 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167767
SMART Domains Protein: ENSMUSP00000132482
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
PDB:3OSE|A 220 264 1e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168852
Predicted Effect probably damaging
Transcript: ENSMUST00000168872
AA Change: D193G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128560
Gene: ENSMUSG00000024969
AA Change: D193G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 661 707 5.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169541
SMART Domains Protein: ENSMUSP00000128779
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 53 110 1.7e-12 PFAM
Pfam:Pkinase_Tyr 53 110 7.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170768
Predicted Effect probably benign
Transcript: ENSMUST00000171352
SMART Domains Protein: ENSMUSP00000129490
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171393
AA Change: D160G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129894
Gene: ENSMUSG00000024969
AA Change: D160G

DomainStartEndE-ValueType
Pfam:Pkinase 20 193 1.2e-59 PFAM
Pfam:Pkinase_Tyr 20 193 1.2e-35 PFAM
Pfam:RIO1 30 174 3e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171721
AA Change: D183G
SMART Domains Protein: ENSMUSP00000129506
Gene: ENSMUSG00000024969
AA Change: D183G

DomainStartEndE-ValueType
S_TKc 44 295 1.59e-108 SMART
UBA 316 353 7.69e-7 SMART
low complexity region 499 513 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Meta Mutation Damage Score 0.49 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency 98% (115/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit proportionate dwarfism with smaller pituitaries and reduced growth hormone and prolactin secretion. Mutants develop autoimmunity and fail to breed when mated to each other. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 76,000,115 probably benign Het
Acsm1 A T 7: 119,658,315 T435S probably damaging Het
Agtpbp1 G A 13: 59,500,200 T602I probably benign Het
Ahnak2 T A 12: 112,785,534 D231V probably damaging Het
Ampd3 G A 7: 110,793,669 D215N probably benign Het
Ankrd17 T C 5: 90,250,405 D1762G probably damaging Het
Asb8 C T 15: 98,142,671 V37I possibly damaging Het
Bicra T C 7: 15,987,511 T694A possibly damaging Het
Btnl6 A T 17: 34,514,299 M234K probably benign Het
Ccnb1 A T 13: 100,779,781 V336D probably damaging Het
Cdca8 A T 4: 124,921,254 L190Q possibly damaging Het
Cep290 A T 10: 100,537,831 L1324F probably damaging Het
Ces1f T C 8: 93,271,885 E161G probably benign Het
Ces2g A G 8: 104,965,996 probably benign Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Clec3b A G 9: 123,157,025 T163A probably benign Het
Cntnap4 T G 8: 112,803,164 L668R probably damaging Het
Col27a1 A G 4: 63,275,977 D857G probably damaging Het
Csf1 A G 3: 107,748,644 V245A probably benign Het
Ctss A G 3: 95,550,137 Y302C probably damaging Het
Cyb5d1 A G 11: 69,394,966 probably null Het
Cyp1a2 A G 9: 57,682,061 S157P probably damaging Het
Cyp2b9 A T 7: 26,200,813 T349S probably benign Het
Dennd6b T C 15: 89,186,183 I428V probably benign Het
Denr A G 5: 123,927,235 probably benign Het
Dnah9 G A 11: 65,969,955 probably benign Het
Dock3 G T 9: 106,913,268 Q1419K possibly damaging Het
Dph3b-ps A T 13: 106,546,867 noncoding transcript Het
Emc7 G T 2: 112,459,485 D87Y probably damaging Het
Enah T C 1: 181,913,373 E462G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Enpp6 A G 8: 47,066,000 K268E probably damaging Het
Eps15l1 T G 8: 72,381,497 probably benign Het
Fam151a T C 4: 106,748,174 Y578H probably benign Het
Fmn2 T C 1: 174,791,314 V1512A probably damaging Het
Focad C A 4: 88,408,959 N168K probably benign Het
Fyco1 A G 9: 123,829,009 C701R probably damaging Het
Gabbr1 G T 17: 37,067,210 probably benign Het
Golga7b A T 19: 42,266,839 E76V probably damaging Het
Gucy2d A G 7: 98,467,752 D924G probably benign Het
H2-M9 A G 17: 36,641,755 F133S probably damaging Het
Hc A G 2: 34,986,292 Y1581H probably damaging Het
Herc3 C T 6: 58,874,308 P514L probably damaging Het
Hormad1 T C 3: 95,585,125 probably benign Het
Iigp1 T A 18: 60,390,787 S326T possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kcnk7 T G 19: 5,707,014 *344G probably null Het
Kif13a A G 13: 46,786,511 probably null Het
Kif1a A C 1: 93,042,358 I1027S probably damaging Het
Kif2c G T 4: 117,165,517 H416Q probably damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mbd4 A G 6: 115,844,568 probably null Het
Micu1 A G 10: 59,788,877 probably null Het
Mink1 T C 11: 70,613,042 W1263R probably damaging Het
Mov10 A C 3: 104,804,603 L224R probably damaging Het
Ndel1 T C 11: 68,836,173 E226G probably damaging Het
Neb A T 2: 52,222,774 V4336E probably damaging Het
Nln T A 13: 104,036,891 K602N probably damaging Het
Nlrp14 A T 7: 107,181,258 probably benign Het
Nmd3 A T 3: 69,748,321 D445V probably damaging Het
Nop14 T C 5: 34,643,953 I625V probably benign Het
Notch1 T C 2: 26,470,931 Q1134R probably damaging Het
Nr4a2 T C 2: 57,108,615 I392M probably benign Het
Olfr1310 T A 2: 112,009,020 L55F probably damaging Het
Olfr702 A G 7: 106,823,756 F257L possibly damaging Het
Olfr983 A G 9: 40,092,253 S234P probably damaging Het
Osbp T C 19: 11,983,958 Y454H probably damaging Het
Pak4 G A 7: 28,564,283 R343C probably damaging Het
Pak7 T C 2: 136,100,784 K479E possibly damaging Het
Pard3 C A 8: 127,161,308 D73E probably damaging Het
Pcdh10 T C 3: 45,380,499 V416A possibly damaging Het
Plek A C 11: 16,985,594 W261G probably damaging Het
Pmp22 A T 11: 63,158,250 probably null Het
Prph2 A C 17: 46,919,771 K197Q probably benign Het
Prss45 T A 9: 110,840,894 L257Q probably damaging Het
Psmb6 C A 11: 70,526,345 H73Q probably benign Het
Rin2 T C 2: 145,878,832 probably benign Het
Rps6kb1 A T 11: 86,511,587 probably null Het
Scn10a C A 9: 119,670,484 D248Y probably damaging Het
Scn4a C T 11: 106,324,560 V1197I probably benign Het
Siglecf A T 7: 43,351,925 I106F probably benign Het
Sik1 A G 17: 31,847,275 probably benign Het
Slc22a21 T G 11: 53,979,688 N57T probably damaging Het
Slc36a2 A G 11: 55,162,795 L339P probably damaging Het
Slc4a9 G T 18: 36,531,666 probably benign Het
Smg1 G A 7: 118,212,443 T104I possibly damaging Het
Stc2 A T 11: 31,365,559 probably null Het
Stx18 T A 5: 38,092,564 Y74N probably damaging Het
Stxbp5 A T 10: 9,762,748 H1102Q probably damaging Het
Tnfaip8l2 G A 3: 95,140,028 L175F probably damaging Het
Tom1l2 T C 11: 60,230,134 K450E probably damaging Het
Tpo T C 12: 30,100,390 Q497R probably benign Het
Tprgl G T 4: 154,160,345 probably benign Het
Triml2 A G 8: 43,185,432 M146V probably benign Het
Tsc2 A G 17: 24,631,004 probably benign Het
Vit G A 17: 78,599,835 G229R probably benign Het
Vmn2r19 C T 6: 123,331,547 L528F probably benign Het
Vwf T A 6: 125,682,812 I2658N probably benign Het
Wdfy3 T C 5: 101,845,046 D3341G probably damaging Het
Wdr36 T A 18: 32,859,307 D632E probably damaging Het
Wdr47 G T 3: 108,637,991 A733S probably damaging Het
Zcchc6 A T 13: 59,805,328 D99E probably benign Het
Zfp458 T A 13: 67,257,898 H156L probably damaging Het
Zfp654 A G 16: 64,784,818 V466A probably benign Het
Zfp804b T C 5: 6,771,665 E466G probably damaging Het
Zfp941 T C 7: 140,813,272 D58G probably benign Het
Other mutations in Mark2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Mark2 APN 19 7341184 missense possibly damaging 0.53
IGL01522:Mark2 APN 19 7281238 missense probably benign 0.06
IGL02368:Mark2 APN 19 7284490 missense probably damaging 1.00
IGL02836:Mark2 APN 19 7278040 critical splice donor site probably null
IGL03233:Mark2 APN 19 7284726 missense possibly damaging 0.89
R0015:Mark2 UTSW 19 7285777 nonsense probably null
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0335:Mark2 UTSW 19 7281828 missense probably benign 0.27
R0627:Mark2 UTSW 19 7281960 critical splice acceptor site probably null
R0734:Mark2 UTSW 19 7285981 splice site probably benign
R0744:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R0836:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R1099:Mark2 UTSW 19 7277425 missense probably benign 0.41
R1861:Mark2 UTSW 19 7290763 missense possibly damaging 0.73
R1873:Mark2 UTSW 19 7284515 missense probably damaging 1.00
R2160:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2161:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2162:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2308:Mark2 UTSW 19 7281934 missense probably damaging 1.00
R2844:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2845:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2846:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2902:Mark2 UTSW 19 7283448 missense probably benign 0.00
R2935:Mark2 UTSW 19 7285889 missense probably benign 0.09
R3853:Mark2 UTSW 19 7277290 missense probably damaging 1.00
R4377:Mark2 UTSW 19 7290689 missense possibly damaging 0.66
R4522:Mark2 UTSW 19 7285948 missense probably damaging 1.00
R4737:Mark2 UTSW 19 7281232 missense probably damaging 0.96
R5103:Mark2 UTSW 19 7284503 missense probably damaging 1.00
R5154:Mark2 UTSW 19 7283074 missense probably damaging 0.99
R5579:Mark2 UTSW 19 7282816 missense probably damaging 1.00
R6163:Mark2 UTSW 19 7290761 missense probably benign 0.00
R6186:Mark2 UTSW 19 7283202 missense probably benign 0.01
R6387:Mark2 UTSW 19 7285902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCCTGCATTTCACTGCACC -3'
(R):5'- TATCTGTGCTGACTGATGCTGCCC -3'

Sequencing Primer
(F):5'- GGTTCTGTCCATCAAAAGGC -3'
(R):5'- ACTGATGCTGCCCTGGAAG -3'
Posted On2013-05-23