Incidental Mutation 'R0049:Tdrd5'
ID40845
Institutional Source Beutler Lab
Gene Symbol Tdrd5
Ensembl Gene ENSMUSG00000060985
Gene Nametudor domain containing 5
Synonyms
MMRRC Submission 038343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R0049 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156255296-156303664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156301903 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 79 (I79N)
Ref Sequence ENSEMBL: ENSMUSP00000137298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121146] [ENSMUST00000141760] [ENSMUST00000167528]
Predicted Effect probably damaging
Transcript: ENSMUST00000121146
AA Change: I79N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137298
Gene: ENSMUSG00000060985
AA Change: I79N

DomainStartEndE-ValueType
Pfam:OST-HTH 6 76 3.7e-11 PFAM
Pfam:OST-HTH 126 194 1.5e-10 PFAM
Pfam:OST-HTH 290 361 7.4e-10 PFAM
TUDOR 532 590 3.25e-7 SMART
low complexity region 739 753 N/A INTRINSIC
low complexity region 1001 1021 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141760
AA Change: I79N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137156
Gene: ENSMUSG00000060985
AA Change: I79N

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167528
AA Change: I79N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137182
Gene: ENSMUSG00000060985
AA Change: I79N

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 1.4e-9 PFAM
Pfam:OST-HTH 213 284 6.4e-9 PFAM
TUDOR 455 513 3.25e-7 SMART
low complexity region 662 676 N/A INTRINSIC
low complexity region 924 944 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195064
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (114/115)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with defective spermatid elongation, occasional arrested male meiosis, and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,308 H9L possibly damaging Het
Aars T A 8: 111,052,451 I739K possibly damaging Het
Abcb1b T A 5: 8,825,661 H611Q probably damaging Het
Acod1 T A 14: 103,055,207 I389K possibly damaging Het
Adgre1 T A 17: 57,402,841 L166* probably null Het
Akap1 C A 11: 88,839,624 probably null Het
Akna T A 4: 63,394,635 Q417L probably damaging Het
Anxa7 T C 14: 20,462,610 D285G probably damaging Het
Arhgap1 T C 2: 91,670,169 Y308H probably damaging Het
Arhgef10 A C 8: 14,954,446 R360S probably damaging Het
Arhgef11 T A 3: 87,729,193 probably null Het
Arid3a A G 10: 79,931,065 T58A possibly damaging Het
Atp6v0a4 G A 6: 38,082,081 R256C probably damaging Het
Camsap3 C A 8: 3,598,772 S163R probably benign Het
Ccdc110 A T 8: 45,942,626 E518V probably damaging Het
Ccdc180 G A 4: 45,930,119 probably null Het
Ccnt1 T C 15: 98,565,079 M71V probably benign Het
Celsr2 T A 3: 108,397,254 Y2263F probably benign Het
Cfap36 A T 11: 29,246,514 probably null Het
Cfap69 T C 5: 5,613,734 T498A probably benign Het
Chadl T C 15: 81,694,012 D6G probably benign Het
Clstn3 T A 6: 124,459,853 I132F possibly damaging Het
Cnot4 A G 6: 35,051,277 V468A probably benign Het
Crmp1 T G 5: 37,265,273 D141E possibly damaging Het
Crtc1 A G 8: 70,391,859 probably null Het
Cryz C A 3: 154,611,552 A136D probably damaging Het
Dph6 A G 2: 114,523,044 V221A probably benign Het
Dst A T 1: 34,275,781 N4267Y probably damaging Het
Duox2 T A 2: 122,296,686 D170V possibly damaging Het
Ecm2 A T 13: 49,524,446 K403* probably null Het
Eif3d T C 15: 77,959,724 N474S probably benign Het
Elf1 T C 14: 79,565,525 L106P probably damaging Het
Exoc4 G C 6: 33,296,922 probably null Het
F12 T C 13: 55,426,317 D34G probably benign Het
Fam214b A T 4: 43,036,441 S97T probably benign Het
Fam228b A T 12: 4,748,117 F200Y probably damaging Het
Fgl2 T A 5: 21,375,663 D334E possibly damaging Het
Fras1 T A 5: 96,776,622 F3641I probably benign Het
Gabrb2 T G 11: 42,593,847 Y244D probably damaging Het
Gcc1 A T 6: 28,421,269 D16E probably benign Het
Gga3 C A 11: 115,587,089 G558* probably null Het
Glt1d1 T C 5: 127,663,327 probably benign Het
Gm6614 T C 6: 141,990,421 T313A probably benign Het
Gorasp2 T C 2: 70,690,723 S346P possibly damaging Het
Hcn4 T C 9: 58,860,299 S1048P probably damaging Het
Henmt1 T A 3: 108,953,789 probably benign Het
Htt A C 5: 34,908,662 K3060N probably damaging Het
Ibsp C T 5: 104,302,158 L8F probably damaging Het
Kif27 A T 13: 58,303,564 D983E probably damaging Het
Kif3a T A 11: 53,590,733 probably benign Het
Kif3c A C 12: 3,367,090 K370N possibly damaging Het
Loxhd1 T C 18: 77,380,560 probably benign Het
Maz A T 7: 127,024,586 D74E probably damaging Het
Med21 T C 6: 146,650,234 S128P probably damaging Het
Mms19 A C 19: 41,955,168 M374R probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mrpl3 T C 9: 105,055,673 V111A probably benign Het
Mtfr2 T A 10: 20,348,412 Y31N probably damaging Het
Myh3 C T 11: 67,099,672 R1677C probably damaging Het
Mynn T A 3: 30,607,081 *61K probably null Het
Neb A C 2: 52,170,467 M2286R possibly damaging Het
Ngf A T 3: 102,520,345 R137* probably null Het
Nr1i3 T A 1: 171,214,413 V22E probably damaging Het
Nxpe5 T C 5: 138,251,304 V452A probably damaging Het
Oas1e C A 5: 120,795,330 A57S probably benign Het
Olfr116 T A 17: 37,624,133 R167S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A T 14: 50,533,694 K94M probably damaging Het
Pax3 A G 1: 78,103,504 L415P probably damaging Het
Pcnt G T 10: 76,369,821 probably benign Het
Peg3 G T 7: 6,711,673 D183E possibly damaging Het
Pglyrp1 G T 7: 18,889,388 G120V probably damaging Het
Pnp2 T A 14: 50,959,533 Y25* probably null Het
Pomt1 T A 2: 32,252,011 H584Q possibly damaging Het
Ppp1r12a A G 10: 108,253,332 N611D possibly damaging Het
Prkcq G A 2: 11,283,832 G532E probably benign Het
Prl6a1 A T 13: 27,317,997 I116F probably damaging Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Pwp1 A G 10: 85,885,616 T361A possibly damaging Het
Rab4a A T 8: 123,827,342 H5L probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Ramp1 T C 1: 91,196,870 I51T possibly damaging Het
Raph1 G T 1: 60,525,899 T143K probably benign Het
Rhpn1 A G 15: 75,709,239 E110G possibly damaging Het
Rnf168 A T 16: 32,298,469 T283S possibly damaging Het
Ros1 T A 10: 52,101,761 Y1463F possibly damaging Het
Rtn4ip1 A G 10: 43,921,434 Q223R probably null Het
Rtp4 G T 16: 23,612,929 M70I probably benign Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Satb1 T A 17: 51,740,346 Q647L probably benign Het
Sec31b T C 19: 44,520,408 probably benign Het
Sgo1 C T 17: 53,679,663 D167N probably damaging Het
Smchd1 T C 17: 71,431,236 I545V probably benign Het
St6gal1 G T 16: 23,321,141 A21S probably damaging Het
Stard9 C A 2: 120,699,819 L2186I probably damaging Het
Sun2 T A 15: 79,727,609 probably benign Het
Taf4 G A 2: 179,924,091 T849M probably damaging Het
Tdrd7 A G 4: 45,987,582 I72V probably damaging Het
Tnxb T A 17: 34,709,568 V2652E possibly damaging Het
Trim30a C T 7: 104,429,352 probably null Het
Tshz3 A G 7: 36,770,109 T508A probably damaging Het
Ttc21b A G 2: 66,223,564 L757P probably damaging Het
Ubtd2 A C 11: 32,499,223 probably null Het
Ubtd2 G T 11: 32,499,224 probably null Het
Vmn1r218 C T 13: 23,137,055 Q111* probably null Het
Vmn2r75 G A 7: 86,148,101 Q835* probably null Het
Vwa8 T A 14: 79,093,739 M1229K probably benign Het
Wdr76 C T 2: 121,519,451 R111C probably damaging Het
Xcr1 T A 9: 123,855,875 D274V possibly damaging Het
Ypel5 C T 17: 72,846,337 T12I probably benign Het
Other mutations in Tdrd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Tdrd5 APN 1 156301827 missense probably benign 0.32
IGL02441:Tdrd5 APN 1 156259943 splice site probably benign
IGL02932:Tdrd5 APN 1 156270620 missense possibly damaging 0.52
R0416:Tdrd5 UTSW 1 156285481 missense probably damaging 0.96
R0518:Tdrd5 UTSW 1 156262941 missense probably damaging 0.99
R1439:Tdrd5 UTSW 1 156277487 missense probably damaging 1.00
R1454:Tdrd5 UTSW 1 156259836 missense probably benign 0.41
R1497:Tdrd5 UTSW 1 156255802 missense probably benign 0.28
R1774:Tdrd5 UTSW 1 156277509 missense probably damaging 1.00
R2101:Tdrd5 UTSW 1 156301639 missense probably damaging 1.00
R2125:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2126:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2197:Tdrd5 UTSW 1 156259865 missense probably benign 0.02
R3820:Tdrd5 UTSW 1 156285483 missense probably benign 0.16
R3928:Tdrd5 UTSW 1 156300778 missense probably benign 0.06
R4258:Tdrd5 UTSW 1 156259742 missense probably benign 0.00
R4502:Tdrd5 UTSW 1 156300764 missense probably benign 0.00
R4601:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4602:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4610:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4611:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4674:Tdrd5 UTSW 1 156277435 missense probably damaging 1.00
R4722:Tdrd5 UTSW 1 156302375 missense probably benign 0.31
R4778:Tdrd5 UTSW 1 156255587 missense probably damaging 0.98
R5737:Tdrd5 UTSW 1 156300724 missense probably benign 0.01
R5881:Tdrd5 UTSW 1 156294500 missense probably damaging 0.98
R5900:Tdrd5 UTSW 1 156277435 nonsense probably null
R6234:Tdrd5 UTSW 1 156293377 missense possibly damaging 0.93
R6557:Tdrd5 UTSW 1 156300721 missense probably benign 0.10
R7068:Tdrd5 UTSW 1 156284271 missense probably damaging 1.00
R7184:Tdrd5 UTSW 1 156259935 missense not run
R7199:Tdrd5 UTSW 1 156301723 missense not run
X0026:Tdrd5 UTSW 1 156285427 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGTCCAAAACGCCTGGCAAATG -3'
(R):5'- TGTCAGAAATGATGGACCCAACAGC -3'

Sequencing Primer
(F):5'- GGCAAATGCCTTTTCAAAGTCAG -3'
(R):5'- ATGGACCCAACAGCTTTGTC -3'
Posted On2013-05-23