Incidental Mutation 'R0049:Taf4'
ID40857
Institutional Source Beutler Lab
Gene Symbol Taf4
Ensembl Gene ENSMUSG00000039117
Gene NameTATA-box binding protein associated factor 4
SynonymsTaf4a, Taf2c1, TAFII130, TAFII135
MMRRC Submission 038343-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0049 (G1)
Quality Score197
Status Validated
Chromosome2
Chromosomal Location179912152-179976646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 179924091 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 849 (T849M)
Ref Sequence ENSEMBL: ENSMUSP00000038610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]
Predicted Effect probably damaging
Transcript: ENSMUST00000041618
AA Change: T849M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: T849M

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 64 181 N/A INTRINSIC
SCOP:d1hqva_ 312 325 6e-3 SMART
low complexity region 339 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
internal_repeat_1 465 500 2.85e-5 PROSPERO
low complexity region 537 547 N/A INTRINSIC
TAFH 550 642 4.9e-54 SMART
internal_repeat_1 692 727 2.85e-5 PROSPERO
low complexity region 767 773 N/A INTRINSIC
Pfam:TAF4 791 1039 3.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155335
Predicted Effect possibly damaging
Transcript: ENSMUST00000227325
AA Change: T837M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,308 H9L possibly damaging Het
Aars T A 8: 111,052,451 I739K possibly damaging Het
Abcb1b T A 5: 8,825,661 H611Q probably damaging Het
Acod1 T A 14: 103,055,207 I389K possibly damaging Het
Adgre1 T A 17: 57,402,841 L166* probably null Het
Akap1 C A 11: 88,839,624 probably null Het
Akna T A 4: 63,394,635 Q417L probably damaging Het
Anxa7 T C 14: 20,462,610 D285G probably damaging Het
Arhgap1 T C 2: 91,670,169 Y308H probably damaging Het
Arhgef10 A C 8: 14,954,446 R360S probably damaging Het
Arhgef11 T A 3: 87,729,193 probably null Het
Arid3a A G 10: 79,931,065 T58A possibly damaging Het
Atp6v0a4 G A 6: 38,082,081 R256C probably damaging Het
Camsap3 C A 8: 3,598,772 S163R probably benign Het
Ccdc110 A T 8: 45,942,626 E518V probably damaging Het
Ccdc180 G A 4: 45,930,119 probably null Het
Ccnt1 T C 15: 98,565,079 M71V probably benign Het
Celsr2 T A 3: 108,397,254 Y2263F probably benign Het
Cfap36 A T 11: 29,246,514 probably null Het
Cfap69 T C 5: 5,613,734 T498A probably benign Het
Chadl T C 15: 81,694,012 D6G probably benign Het
Clstn3 T A 6: 124,459,853 I132F possibly damaging Het
Cnot4 A G 6: 35,051,277 V468A probably benign Het
Crmp1 T G 5: 37,265,273 D141E possibly damaging Het
Crtc1 A G 8: 70,391,859 probably null Het
Cryz C A 3: 154,611,552 A136D probably damaging Het
Dph6 A G 2: 114,523,044 V221A probably benign Het
Dst A T 1: 34,275,781 N4267Y probably damaging Het
Duox2 T A 2: 122,296,686 D170V possibly damaging Het
Ecm2 A T 13: 49,524,446 K403* probably null Het
Eif3d T C 15: 77,959,724 N474S probably benign Het
Elf1 T C 14: 79,565,525 L106P probably damaging Het
Exoc4 G C 6: 33,296,922 probably null Het
F12 T C 13: 55,426,317 D34G probably benign Het
Fam214b A T 4: 43,036,441 S97T probably benign Het
Fam228b A T 12: 4,748,117 F200Y probably damaging Het
Fgl2 T A 5: 21,375,663 D334E possibly damaging Het
Fras1 T A 5: 96,776,622 F3641I probably benign Het
Gabrb2 T G 11: 42,593,847 Y244D probably damaging Het
Gcc1 A T 6: 28,421,269 D16E probably benign Het
Gga3 C A 11: 115,587,089 G558* probably null Het
Glt1d1 T C 5: 127,663,327 probably benign Het
Gm6614 T C 6: 141,990,421 T313A probably benign Het
Gorasp2 T C 2: 70,690,723 S346P possibly damaging Het
Hcn4 T C 9: 58,860,299 S1048P probably damaging Het
Henmt1 T A 3: 108,953,789 probably benign Het
Htt A C 5: 34,908,662 K3060N probably damaging Het
Ibsp C T 5: 104,302,158 L8F probably damaging Het
Kif27 A T 13: 58,303,564 D983E probably damaging Het
Kif3a T A 11: 53,590,733 probably benign Het
Kif3c A C 12: 3,367,090 K370N possibly damaging Het
Loxhd1 T C 18: 77,380,560 probably benign Het
Maz A T 7: 127,024,586 D74E probably damaging Het
Med21 T C 6: 146,650,234 S128P probably damaging Het
Mms19 A C 19: 41,955,168 M374R probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mrpl3 T C 9: 105,055,673 V111A probably benign Het
Mtfr2 T A 10: 20,348,412 Y31N probably damaging Het
Myh3 C T 11: 67,099,672 R1677C probably damaging Het
Mynn T A 3: 30,607,081 *61K probably null Het
Neb A C 2: 52,170,467 M2286R possibly damaging Het
Ngf A T 3: 102,520,345 R137* probably null Het
Nr1i3 T A 1: 171,214,413 V22E probably damaging Het
Nxpe5 T C 5: 138,251,304 V452A probably damaging Het
Oas1e C A 5: 120,795,330 A57S probably benign Het
Olfr116 T A 17: 37,624,133 R167S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A T 14: 50,533,694 K94M probably damaging Het
Pax3 A G 1: 78,103,504 L415P probably damaging Het
Pcnt G T 10: 76,369,821 probably benign Het
Peg3 G T 7: 6,711,673 D183E possibly damaging Het
Pglyrp1 G T 7: 18,889,388 G120V probably damaging Het
Pnp2 T A 14: 50,959,533 Y25* probably null Het
Pomt1 T A 2: 32,252,011 H584Q possibly damaging Het
Ppp1r12a A G 10: 108,253,332 N611D possibly damaging Het
Prkcq G A 2: 11,283,832 G532E probably benign Het
Prl6a1 A T 13: 27,317,997 I116F probably damaging Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Pwp1 A G 10: 85,885,616 T361A possibly damaging Het
Rab4a A T 8: 123,827,342 H5L probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Ramp1 T C 1: 91,196,870 I51T possibly damaging Het
Raph1 G T 1: 60,525,899 T143K probably benign Het
Rhpn1 A G 15: 75,709,239 E110G possibly damaging Het
Rnf168 A T 16: 32,298,469 T283S possibly damaging Het
Ros1 T A 10: 52,101,761 Y1463F possibly damaging Het
Rtn4ip1 A G 10: 43,921,434 Q223R probably null Het
Rtp4 G T 16: 23,612,929 M70I probably benign Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Satb1 T A 17: 51,740,346 Q647L probably benign Het
Sec31b T C 19: 44,520,408 probably benign Het
Sgo1 C T 17: 53,679,663 D167N probably damaging Het
Smchd1 T C 17: 71,431,236 I545V probably benign Het
St6gal1 G T 16: 23,321,141 A21S probably damaging Het
Stard9 C A 2: 120,699,819 L2186I probably damaging Het
Sun2 T A 15: 79,727,609 probably benign Het
Tdrd5 A T 1: 156,301,903 I79N probably damaging Het
Tdrd7 A G 4: 45,987,582 I72V probably damaging Het
Tnxb T A 17: 34,709,568 V2652E possibly damaging Het
Trim30a C T 7: 104,429,352 probably null Het
Tshz3 A G 7: 36,770,109 T508A probably damaging Het
Ttc21b A G 2: 66,223,564 L757P probably damaging Het
Ubtd2 A C 11: 32,499,223 probably null Het
Ubtd2 G T 11: 32,499,224 probably null Het
Vmn1r218 C T 13: 23,137,055 Q111* probably null Het
Vmn2r75 G A 7: 86,148,101 Q835* probably null Het
Vwa8 T A 14: 79,093,739 M1229K probably benign Het
Wdr76 C T 2: 121,519,451 R111C probably damaging Het
Xcr1 T A 9: 123,855,875 D274V possibly damaging Het
Ypel5 C T 17: 72,846,337 T12I probably benign Het
Other mutations in Taf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Taf4 APN 2 179976625 missense unknown
IGL00517:Taf4 APN 2 179924413 splice site probably benign
IGL02159:Taf4 APN 2 179938470 missense probably benign 0.24
IGL02254:Taf4 APN 2 179921184 missense probably benign 0.25
IGL03366:Taf4 APN 2 179935054 missense probably damaging 1.00
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R1267:Taf4 UTSW 2 179929324 missense possibly damaging 0.46
R1495:Taf4 UTSW 2 179933027 missense probably damaging 1.00
R1560:Taf4 UTSW 2 179935953 missense probably benign 0.14
R1756:Taf4 UTSW 2 179976531 missense unknown
R1893:Taf4 UTSW 2 179933030 missense probably damaging 0.98
R1932:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R2213:Taf4 UTSW 2 179935890 critical splice donor site probably null
R3896:Taf4 UTSW 2 179932014 missense probably benign 0.45
R4050:Taf4 UTSW 2 179932012 missense probably damaging 1.00
R4448:Taf4 UTSW 2 179935971 missense possibly damaging 0.65
R4736:Taf4 UTSW 2 179924494 missense probably damaging 1.00
R5124:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R6155:Taf4 UTSW 2 179913524 missense probably damaging 1.00
R6238:Taf4 UTSW 2 179932039 missense probably damaging 0.97
R6292:Taf4 UTSW 2 179923987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGAACACGAACATTCTCCCCG -3'
(R):5'- TGTAAAGACGACACCTTCCTCCTCC -3'

Sequencing Primer
(F):5'- CGGGAAAACAGCCTCATTAC -3'
(R):5'- CCATAGAGGCTCCACTGTTG -3'
Posted On2013-05-23