Incidental Mutation 'R0049:Fras1'
ID40873
Institutional Source Beutler Lab
Gene Symbol Fras1
Ensembl Gene ENSMUSG00000034687
Gene NameFraser extracellular matrix complex subunit 1
Synonymsbl, E130113P14Rik
MMRRC Submission 038343-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0049 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location96373955-96784728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96776622 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 3641 (F3641I)
Ref Sequence ENSEMBL: ENSMUSP00000043250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036019]
Predicted Effect probably benign
Transcript: ENSMUST00000036019
AA Change: F3641I

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043250
Gene: ENSMUSG00000034687
AA Change: F3641I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 27 86 9.23e-9 SMART
VWC 94 151 9.37e-10 SMART
VWC 158 215 8.61e-9 SMART
VWC 220 277 7.1e-10 SMART
VWC 284 341 7.8e-7 SMART
VWC 365 415 1.93e-1 SMART
FU 408 459 3.33e-1 SMART
FU 461 504 9.12e-8 SMART
EGF_like 466 495 6.67e1 SMART
FU 506 552 6.01e-8 SMART
FU 554 598 2.21e-6 SMART
FU 601 646 1.28e-11 SMART
FU 648 704 4.19e-7 SMART
FU 707 752 9.12e-8 SMART
FU 754 799 1.11e-6 SMART
EGF_like 759 790 7.23e1 SMART
FU 802 851 5.44e-6 SMART
EGF_like 807 842 4.55e1 SMART
FU 853 899 7.4e-8 SMART
FU 902 947 4.78e-2 SMART
FU 951 996 4.52e-12 SMART
EGF_like 956 987 2.75e1 SMART
FU 998 1041 1.38e-7 SMART
FU 1045 1088 9.7e-3 SMART
EGF_like 1057 1096 3.16e1 SMART
Pfam:Cadherin_3 1098 1198 5.2e-12 PFAM
Pfam:Cadherin_3 1167 1309 6.5e-27 PFAM
Pfam:Cadherin_3 1278 1442 7e-24 PFAM
Pfam:Cadherin_3 1411 1560 1.3e-23 PFAM
Pfam:Cadherin_3 1561 1693 6.4e-15 PFAM
Pfam:Cadherin_3 1695 1814 1.1e-10 PFAM
Pfam:Cadherin_3 1780 1940 1.6e-18 PFAM
Pfam:Cadherin_3 1906 2061 2.8e-22 PFAM
Pfam:Cadherin_3 2063 2181 3.3e-18 PFAM
Pfam:Cadherin_3 2172 2295 1.4e-26 PFAM
Pfam:Cadherin_3 2296 2408 2.3e-31 PFAM
Pfam:Cadherin_3 2413 2540 7.9e-23 PFAM
Calx_beta 2544 2648 1.23e-10 SMART
Calx_beta 2661 2772 3.3e-11 SMART
Calx_beta 2787 2892 1.21e-9 SMART
Calx_beta 2907 3009 4.45e-3 SMART
Calx_beta 3027 3131 1.5e-14 SMART
Blast:Calx_beta 3162 3187 1e-5 BLAST
transmembrane domain 3902 3924 N/A INTRINSIC
low complexity region 3927 3935 N/A INTRINSIC
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Survival is variable on genetic backgrounds. Kidney development is severely affected and syndactyly is common. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,308 H9L possibly damaging Het
Aars T A 8: 111,052,451 I739K possibly damaging Het
Abcb1b T A 5: 8,825,661 H611Q probably damaging Het
Acod1 T A 14: 103,055,207 I389K possibly damaging Het
Adgre1 T A 17: 57,402,841 L166* probably null Het
Akap1 C A 11: 88,839,624 probably null Het
Akna T A 4: 63,394,635 Q417L probably damaging Het
Anxa7 T C 14: 20,462,610 D285G probably damaging Het
Arhgap1 T C 2: 91,670,169 Y308H probably damaging Het
Arhgef10 A C 8: 14,954,446 R360S probably damaging Het
Arhgef11 T A 3: 87,729,193 probably null Het
Arid3a A G 10: 79,931,065 T58A possibly damaging Het
Atp6v0a4 G A 6: 38,082,081 R256C probably damaging Het
Camsap3 C A 8: 3,598,772 S163R probably benign Het
Ccdc110 A T 8: 45,942,626 E518V probably damaging Het
Ccdc180 G A 4: 45,930,119 probably null Het
Ccnt1 T C 15: 98,565,079 M71V probably benign Het
Celsr2 T A 3: 108,397,254 Y2263F probably benign Het
Cfap36 A T 11: 29,246,514 probably null Het
Cfap69 T C 5: 5,613,734 T498A probably benign Het
Chadl T C 15: 81,694,012 D6G probably benign Het
Clstn3 T A 6: 124,459,853 I132F possibly damaging Het
Cnot4 A G 6: 35,051,277 V468A probably benign Het
Crmp1 T G 5: 37,265,273 D141E possibly damaging Het
Crtc1 A G 8: 70,391,859 probably null Het
Cryz C A 3: 154,611,552 A136D probably damaging Het
Dph6 A G 2: 114,523,044 V221A probably benign Het
Dst A T 1: 34,275,781 N4267Y probably damaging Het
Duox2 T A 2: 122,296,686 D170V possibly damaging Het
Ecm2 A T 13: 49,524,446 K403* probably null Het
Eif3d T C 15: 77,959,724 N474S probably benign Het
Elf1 T C 14: 79,565,525 L106P probably damaging Het
Exoc4 G C 6: 33,296,922 probably null Het
F12 T C 13: 55,426,317 D34G probably benign Het
Fam214b A T 4: 43,036,441 S97T probably benign Het
Fam228b A T 12: 4,748,117 F200Y probably damaging Het
Fgl2 T A 5: 21,375,663 D334E possibly damaging Het
Gabrb2 T G 11: 42,593,847 Y244D probably damaging Het
Gcc1 A T 6: 28,421,269 D16E probably benign Het
Gga3 C A 11: 115,587,089 G558* probably null Het
Glt1d1 T C 5: 127,663,327 probably benign Het
Gm6614 T C 6: 141,990,421 T313A probably benign Het
Gorasp2 T C 2: 70,690,723 S346P possibly damaging Het
Hcn4 T C 9: 58,860,299 S1048P probably damaging Het
Henmt1 T A 3: 108,953,789 probably benign Het
Htt A C 5: 34,908,662 K3060N probably damaging Het
Ibsp C T 5: 104,302,158 L8F probably damaging Het
Kif27 A T 13: 58,303,564 D983E probably damaging Het
Kif3a T A 11: 53,590,733 probably benign Het
Kif3c A C 12: 3,367,090 K370N possibly damaging Het
Loxhd1 T C 18: 77,380,560 probably benign Het
Maz A T 7: 127,024,586 D74E probably damaging Het
Med21 T C 6: 146,650,234 S128P probably damaging Het
Mms19 A C 19: 41,955,168 M374R probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mrpl3 T C 9: 105,055,673 V111A probably benign Het
Mtfr2 T A 10: 20,348,412 Y31N probably damaging Het
Myh3 C T 11: 67,099,672 R1677C probably damaging Het
Mynn T A 3: 30,607,081 *61K probably null Het
Neb A C 2: 52,170,467 M2286R possibly damaging Het
Ngf A T 3: 102,520,345 R137* probably null Het
Nr1i3 T A 1: 171,214,413 V22E probably damaging Het
Nxpe5 T C 5: 138,251,304 V452A probably damaging Het
Oas1e C A 5: 120,795,330 A57S probably benign Het
Olfr116 T A 17: 37,624,133 R167S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A T 14: 50,533,694 K94M probably damaging Het
Pax3 A G 1: 78,103,504 L415P probably damaging Het
Pcnt G T 10: 76,369,821 probably benign Het
Peg3 G T 7: 6,711,673 D183E possibly damaging Het
Pglyrp1 G T 7: 18,889,388 G120V probably damaging Het
Pnp2 T A 14: 50,959,533 Y25* probably null Het
Pomt1 T A 2: 32,252,011 H584Q possibly damaging Het
Ppp1r12a A G 10: 108,253,332 N611D possibly damaging Het
Prkcq G A 2: 11,283,832 G532E probably benign Het
Prl6a1 A T 13: 27,317,997 I116F probably damaging Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Pwp1 A G 10: 85,885,616 T361A possibly damaging Het
Rab4a A T 8: 123,827,342 H5L probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Ramp1 T C 1: 91,196,870 I51T possibly damaging Het
Raph1 G T 1: 60,525,899 T143K probably benign Het
Rhpn1 A G 15: 75,709,239 E110G possibly damaging Het
Rnf168 A T 16: 32,298,469 T283S possibly damaging Het
Ros1 T A 10: 52,101,761 Y1463F possibly damaging Het
Rtn4ip1 A G 10: 43,921,434 Q223R probably null Het
Rtp4 G T 16: 23,612,929 M70I probably benign Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Satb1 T A 17: 51,740,346 Q647L probably benign Het
Sec31b T C 19: 44,520,408 probably benign Het
Sgo1 C T 17: 53,679,663 D167N probably damaging Het
Smchd1 T C 17: 71,431,236 I545V probably benign Het
St6gal1 G T 16: 23,321,141 A21S probably damaging Het
Stard9 C A 2: 120,699,819 L2186I probably damaging Het
Sun2 T A 15: 79,727,609 probably benign Het
Taf4 G A 2: 179,924,091 T849M probably damaging Het
Tdrd5 A T 1: 156,301,903 I79N probably damaging Het
Tdrd7 A G 4: 45,987,582 I72V probably damaging Het
Tnxb T A 17: 34,709,568 V2652E possibly damaging Het
Trim30a C T 7: 104,429,352 probably null Het
Tshz3 A G 7: 36,770,109 T508A probably damaging Het
Ttc21b A G 2: 66,223,564 L757P probably damaging Het
Ubtd2 A C 11: 32,499,223 probably null Het
Ubtd2 G T 11: 32,499,224 probably null Het
Vmn1r218 C T 13: 23,137,055 Q111* probably null Het
Vmn2r75 G A 7: 86,148,101 Q835* probably null Het
Vwa8 T A 14: 79,093,739 M1229K probably benign Het
Wdr76 C T 2: 121,519,451 R111C probably damaging Het
Xcr1 T A 9: 123,855,875 D274V possibly damaging Het
Ypel5 C T 17: 72,846,337 T12I probably benign Het
Other mutations in Fras1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fras1 APN 5 96739358 missense possibly damaging 0.55
IGL00507:Fras1 APN 5 96778189 missense probably damaging 1.00
IGL00672:Fras1 APN 5 96759450 splice site probably benign
IGL00772:Fras1 APN 5 96636112 missense probably benign 0.42
IGL00844:Fras1 APN 5 96534853 splice site probably benign
IGL00913:Fras1 APN 5 96695076 missense probably damaging 0.99
IGL00959:Fras1 APN 5 96781281 missense probably damaging 0.96
IGL00966:Fras1 APN 5 96555221 missense probably benign 0.00
IGL01296:Fras1 APN 5 96673698 missense probably null 0.58
IGL01307:Fras1 APN 5 96781692 missense probably benign
IGL01481:Fras1 APN 5 96657241 missense probably damaging 1.00
IGL01525:Fras1 APN 5 96739336 missense probably damaging 0.99
IGL01599:Fras1 APN 5 96709891 missense possibly damaging 0.94
IGL01646:Fras1 APN 5 96758148 missense probably benign 0.29
IGL01795:Fras1 APN 5 96778045 missense probably damaging 1.00
IGL01867:Fras1 APN 5 96588131 missense probably benign
IGL01869:Fras1 APN 5 96708783 splice site probably benign
IGL01923:Fras1 APN 5 96735280 missense probably damaging 1.00
IGL01982:Fras1 APN 5 96739248 missense possibly damaging 0.46
IGL02109:Fras1 APN 5 96700523 missense probably benign
IGL02132:Fras1 APN 5 96781637 nonsense probably null
IGL02171:Fras1 APN 5 96735181 missense probably benign 0.15
IGL02213:Fras1 APN 5 96645871 nonsense probably null
IGL02277:Fras1 APN 5 96588118 missense probably benign 0.00
IGL02507:Fras1 APN 5 96657408 missense possibly damaging 0.95
IGL02589:Fras1 APN 5 96769513 missense probably damaging 1.00
IGL02671:Fras1 APN 5 96728616 missense possibly damaging 0.91
IGL02677:Fras1 APN 5 96545024 missense probably damaging 1.00
IGL02691:Fras1 APN 5 96744705 missense possibly damaging 0.68
IGL02741:Fras1 APN 5 96691371 missense probably benign 0.35
IGL02836:Fras1 APN 5 96534866 missense possibly damaging 0.67
IGL02850:Fras1 APN 5 96778175 missense probably damaging 1.00
IGL02998:Fras1 APN 5 96702181 missense possibly damaging 0.82
IGL03040:Fras1 APN 5 96710101 missense probably benign
IGL03078:Fras1 APN 5 96636135 missense probably damaging 1.00
IGL03096:Fras1 APN 5 96764901 missense probably damaging 1.00
IGL03102:Fras1 APN 5 96726535 missense probably benign 0.11
IGL03183:Fras1 APN 5 96733781 splice site probably benign
IGL03189:Fras1 APN 5 96743071 missense probably benign 0.00
IGL03193:Fras1 APN 5 96778106 missense probably damaging 0.99
IGL03292:Fras1 APN 5 96707491 missense probably damaging 1.00
IGL03328:Fras1 APN 5 96781760 missense probably damaging 0.96
IGL03335:Fras1 APN 5 96733944 splice site probably benign
IGL03394:Fras1 APN 5 96667477 missense probably damaging 0.98
IGL03404:Fras1 APN 5 96728581 missense probably damaging 0.99
baby_ruth UTSW 5 96708758 missense probably benign 0.01
I0000:Fras1 UTSW 5 96740829 missense probably damaging 0.99
PIT4581001:Fras1 UTSW 5 96555301 missense probably benign 0.01
R0028:Fras1 UTSW 5 96677316 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0099:Fras1 UTSW 5 96614917 critical splice donor site probably null
R0109:Fras1 UTSW 5 96710077 missense probably benign 0.01
R0158:Fras1 UTSW 5 96776634 missense possibly damaging 0.83
R0268:Fras1 UTSW 5 96737009 missense probably damaging 0.99
R0305:Fras1 UTSW 5 96596888 missense probably benign
R0352:Fras1 UTSW 5 96726540 missense probably damaging 0.97
R0359:Fras1 UTSW 5 96762590 missense probably damaging 0.98
R0371:Fras1 UTSW 5 96555331 missense possibly damaging 0.90
R0379:Fras1 UTSW 5 96755509 nonsense probably null
R0395:Fras1 UTSW 5 96769653 missense possibly damaging 0.50
R0417:Fras1 UTSW 5 96691372 missense probably benign 0.18
R0454:Fras1 UTSW 5 96762665 missense probably damaging 0.96
R0456:Fras1 UTSW 5 96554788 missense probably damaging 1.00
R0456:Fras1 UTSW 5 96714343 splice site probably null
R0464:Fras1 UTSW 5 96636803 missense probably damaging 0.98
R0613:Fras1 UTSW 5 96700488 splice site probably benign
R0652:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R0675:Fras1 UTSW 5 96667387 splice site probably benign
R0765:Fras1 UTSW 5 96552796 missense probably benign 0.00
R0783:Fras1 UTSW 5 96768430 missense probably damaging 1.00
R0811:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0812:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0943:Fras1 UTSW 5 96726543 missense probably benign 0.00
R1037:Fras1 UTSW 5 96714463 missense probably damaging 0.97
R1104:Fras1 UTSW 5 96708671 missense probably benign 0.00
R1108:Fras1 UTSW 5 96642629 missense probably damaging 0.99
R1332:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1336:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1458:Fras1 UTSW 5 96600733 missense probably benign 0.00
R1495:Fras1 UTSW 5 96528586 missense possibly damaging 0.49
R1499:Fras1 UTSW 5 96743187 missense probably benign 0.31
R1528:Fras1 UTSW 5 96636819 missense probably damaging 0.99
R1532:Fras1 UTSW 5 96713996 missense probably damaging 1.00
R1556:Fras1 UTSW 5 96743062 missense possibly damaging 0.88
R1625:Fras1 UTSW 5 96709978 missense possibly damaging 0.94
R1625:Fras1 UTSW 5 96713990 missense probably damaging 1.00
R1645:Fras1 UTSW 5 96700586 missense possibly damaging 0.90
R1647:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1648:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1661:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1665:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1682:Fras1 UTSW 5 96645873 missense probably benign 0.00
R1701:Fras1 UTSW 5 96600784 missense probably benign 0.00
R1716:Fras1 UTSW 5 96552725 missense probably benign 0.10
R1718:Fras1 UTSW 5 96554889 splice site probably null
R1800:Fras1 UTSW 5 96709882 missense probably benign
R1806:Fras1 UTSW 5 96713970 splice site probably benign
R1806:Fras1 UTSW 5 96764976 missense possibly damaging 0.88
R1822:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1823:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1824:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1847:Fras1 UTSW 5 96749423 intron probably null
R1929:Fras1 UTSW 5 96667437 missense probably benign 0.24
R1951:Fras1 UTSW 5 96712383 missense probably benign 0.38
R2093:Fras1 UTSW 5 96781203 missense probably damaging 1.00
R2283:Fras1 UTSW 5 96654305 missense probably benign 0.10
R2884:Fras1 UTSW 5 96700268 missense probably benign 0.07
R2913:Fras1 UTSW 5 96733915 missense probably benign
R2914:Fras1 UTSW 5 96733915 missense probably benign
R3054:Fras1 UTSW 5 96764943 missense probably damaging 0.99
R3117:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3118:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3691:Fras1 UTSW 5 96781512 missense probably benign 0.02
R3714:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3715:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3801:Fras1 UTSW 5 96733932 missense probably benign 0.26
R3961:Fras1 UTSW 5 96677385 critical splice donor site probably null
R4065:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4066:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4076:Fras1 UTSW 5 96743158 missense probably damaging 1.00
R4124:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4127:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4153:Fras1 UTSW 5 96776735 missense probably benign 0.17
R4233:Fras1 UTSW 5 96714376 missense possibly damaging 0.91
R4273:Fras1 UTSW 5 96614904 missense probably benign 0.00
R4355:Fras1 UTSW 5 96700242 missense probably benign
R4401:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4402:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4403:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4505:Fras1 UTSW 5 96781348 missense probably damaging 1.00
R4548:Fras1 UTSW 5 96709895 missense probably benign 0.00
R4559:Fras1 UTSW 5 96781289 missense probably damaging 1.00
R4629:Fras1 UTSW 5 96776734 missense probably benign 0.00
R4637:Fras1 UTSW 5 96778088 missense probably damaging 1.00
R4678:Fras1 UTSW 5 96700568 missense probably benign 0.13
R4707:Fras1 UTSW 5 96735238 missense probably damaging 0.96
R4735:Fras1 UTSW 5 96588163 missense probably benign 0.00
R4756:Fras1 UTSW 5 96781659 missense probably benign 0.00
R4762:Fras1 UTSW 5 96731618 missense probably benign
R4820:Fras1 UTSW 5 96728653 missense probably benign 0.00
R4847:Fras1 UTSW 5 96544992 missense possibly damaging 0.94
R4857:Fras1 UTSW 5 96778159 missense probably benign 0.00
R4909:Fras1 UTSW 5 96708758 missense probably benign 0.01
R4931:Fras1 UTSW 5 96636840 missense probably benign 0.02
R4938:Fras1 UTSW 5 96776724 missense probably damaging 0.99
R4952:Fras1 UTSW 5 96647498 missense probably benign 0.01
R4965:Fras1 UTSW 5 96726580 missense possibly damaging 0.95
R4989:Fras1 UTSW 5 96650682 missense possibly damaging 0.75
R5151:Fras1 UTSW 5 96645110 missense probably damaging 1.00
R5168:Fras1 UTSW 5 96708757 missense probably benign 0.00
R5182:Fras1 UTSW 5 96636173 nonsense probably null
R5214:Fras1 UTSW 5 96769593 missense probably damaging 1.00
R5220:Fras1 UTSW 5 96768363 missense probably damaging 1.00
R5235:Fras1 UTSW 5 96600750 missense probably benign 0.02
R5242:Fras1 UTSW 5 96657250 missense probably benign 0.11
R5253:Fras1 UTSW 5 96741025 missense probably damaging 0.99
R5260:Fras1 UTSW 5 96735187 missense possibly damaging 0.79
R5301:Fras1 UTSW 5 96657266 missense possibly damaging 0.88
R5411:Fras1 UTSW 5 96645160 missense probably benign 0.00
R5467:Fras1 UTSW 5 96780053 missense probably benign 0.04
R5543:Fras1 UTSW 5 96528535 missense probably benign 0.01
R5555:Fras1 UTSW 5 96677377 missense probably benign 0.34
R5602:Fras1 UTSW 5 96737021 missense probably damaging 1.00
R5664:Fras1 UTSW 5 96728535 missense possibly damaging 0.91
R5695:Fras1 UTSW 5 96781344 missense probably damaging 1.00
R5717:Fras1 UTSW 5 96781737 missense possibly damaging 0.93
R5742:Fras1 UTSW 5 96768381 missense possibly damaging 0.50
R5759:Fras1 UTSW 5 96709916 missense probably benign 0.02
R5766:Fras1 UTSW 5 96731689 missense possibly damaging 0.91
R5890:Fras1 UTSW 5 96645948 missense probably benign
R6052:Fras1 UTSW 5 96764866 missense probably damaging 1.00
R6058:Fras1 UTSW 5 96709985 missense probably benign
R6256:Fras1 UTSW 5 96733843 missense possibly damaging 0.84
R6306:Fras1 UTSW 5 96764946 missense probably damaging 1.00
R6494:Fras1 UTSW 5 96759564 missense possibly damaging 0.59
R6638:Fras1 UTSW 5 96758094 missense possibly damaging 0.94
R6647:Fras1 UTSW 5 96735202 missense probably damaging 1.00
R6725:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R6769:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6771:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6837:Fras1 UTSW 5 96726973 missense probably damaging 0.99
R6841:Fras1 UTSW 5 96728551 missense probably damaging 0.99
R6863:Fras1 UTSW 5 96543306 missense probably benign 0.19
R6868:Fras1 UTSW 5 96682378 missense probably benign 0.38
R6936:Fras1 UTSW 5 96768352 missense possibly damaging 0.92
R6997:Fras1 UTSW 5 96614873 nonsense probably null
R7023:Fras1 UTSW 5 96710084 missense probably benign 0.00
R7091:Fras1 UTSW 5 96708676 missense probably benign
R7102:Fras1 UTSW 5 96571041 missense probably benign
R7120:Fras1 UTSW 5 96752960 nonsense probably null
R7124:Fras1 UTSW 5 96714401 missense probably damaging 1.00
R7129:Fras1 UTSW 5 96781284 missense probably benign 0.00
R7173:Fras1 UTSW 5 96778078 missense probably damaging 1.00
R7174:Fras1 UTSW 5 96755577 critical splice donor site probably null
R7185:Fras1 UTSW 5 96636776 missense probably damaging 1.00
R7191:Fras1 UTSW 5 96614912 missense probably benign 0.05
R7216:Fras1 UTSW 5 96739314 missense probably damaging 1.00
R7222:Fras1 UTSW 5 96636186 missense probably damaging 1.00
R7222:Fras1 UTSW 5 96636809 missense probably benign 0.00
R7320:Fras1 UTSW 5 96709886 missense probably benign 0.03
R7335:Fras1 UTSW 5 96736970 missense possibly damaging 0.82
R7378:Fras1 UTSW 5 96596785 missense probably damaging 0.98
R7394:Fras1 UTSW 5 96712450 nonsense probably null
R7412:Fras1 UTSW 5 96614889 missense probably benign 0.06
R7422:Fras1 UTSW 5 96673599 missense probably benign 0.21
R7552:Fras1 UTSW 5 96768438 missense not run
R7559:Fras1 UTSW 5 96740854 missense not run
Z1088:Fras1 UTSW 5 96743211 missense probably damaging 0.97
Z1088:Fras1 UTSW 5 96758142 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGAGTGTTGGAGTGACCTTAGC -3'
(R):5'- GAAGCAACTCACCTTTGGAAAAGGC -3'

Sequencing Primer
(F):5'- cctgaaaagaaagaggaaggaaac -3'
(R):5'- ACCTTTGGAAAAGGCTCCTTTG -3'
Posted On2013-05-23