Incidental Mutation 'R0054:Nsl1'
ID40953
Institutional Source Beutler Lab
Gene Symbol Nsl1
Ensembl Gene ENSMUSG00000062510
Gene NameNSL1, MIS12 kinetochore complex component
SynonymsLOC381318, 4833432M17Rik
MMRRC Submission 038348-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191063012-191086474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191082184 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 194 (L194P)
Ref Sequence ENSEMBL: ENSMUSP00000077380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078259]
Predicted Effect probably damaging
Transcript: ENSMUST00000078259
AA Change: L194P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077380
Gene: ENSMUSG00000062510
AA Change: L194P

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 82 197 2.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192879
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cdh17 A G 4: 11,785,186 Y326C possibly damaging Het
Cgn A T 3: 94,762,592 D1080E possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Farsb T A 1: 78,462,374 K395* probably null Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gphn A G 12: 78,637,503 S558G probably damaging Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kpna6 T C 4: 129,657,458 M85V probably benign Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Ncoa3 A G 2: 166,055,178 T630A possibly damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp385c G A 11: 100,629,956 P293S probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Nsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Nsl1 APN 1 191071201 missense probably benign 0.06
IGL03398:Nsl1 APN 1 191082164 splice site probably benign
IGL02988:Nsl1 UTSW 1 191063103 nonsense probably null
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0284:Nsl1 UTSW 1 191065230 missense probably damaging 1.00
R0482:Nsl1 UTSW 1 191063040 start codon destroyed probably null 0.83
R1776:Nsl1 UTSW 1 191063188 missense probably benign
R5187:Nsl1 UTSW 1 191075190 missense probably benign 0.01
R5470:Nsl1 UTSW 1 191080540 missense probably benign 0.24
R5838:Nsl1 UTSW 1 191070113 missense probably benign 0.02
R6133:Nsl1 UTSW 1 191071206 missense probably damaging 0.99
R6636:Nsl1 UTSW 1 191075127 missense probably benign 0.00
R6817:Nsl1 UTSW 1 191063274 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGAATGAGCCACGTCTTCTGAG -3'
(R):5'- AGGCATCAGACTGTGACCCAAATG -3'

Sequencing Primer
(F):5'- GCCACGTCTTCTGAGTCTGAG -3'
(R):5'- CTTTAGCACAATGTCGGAGGC -3'
Posted On2013-05-23