Incidental Mutation 'R0054:Ncoa3'
ID40965
Institutional Source Beutler Lab
Gene Symbol Ncoa3
Ensembl Gene ENSMUSG00000027678
Gene Namenuclear receptor coactivator 3
SynonymsTRAM-1, RAC3, AIB1, Src3, KAT13B, TRAM1, pCIP, bHLHe42, 2010305B15Rik
MMRRC Submission 038348-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165992636-166073242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166055178 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 630 (T630A)
Ref Sequence ENSEMBL: ENSMUSP00000085416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088095] [ENSMUST00000109252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088095
AA Change: T630A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: T630A

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 1.6e-34 PFAM
Pfam:NCOA_u2 451 564 7.1e-46 PFAM
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 1.6e-32 PFAM
Pfam:DUF4927 714 801 2e-32 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1104 2.1e-27 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1221 1233 N/A INTRINSIC
low complexity region 1243 1263 N/A INTRINSIC
DUF1518 1270 1327 1.08e-21 SMART
low complexity region 1384 1398 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109252
AA Change: T630A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: T630A

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 4.1e-34 PFAM
low complexity region 438 467 N/A INTRINSIC
low complexity region 502 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 3.5e-28 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1106 6.6e-29 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
low complexity region 1242 1262 N/A INTRINSIC
DUF1518 1269 1326 1.08e-21 SMART
low complexity region 1383 1397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153507
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cdh17 A G 4: 11,785,186 Y326C possibly damaging Het
Cgn A T 3: 94,762,592 D1080E possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Farsb T A 1: 78,462,374 K395* probably null Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gphn A G 12: 78,637,503 S558G probably damaging Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kpna6 T C 4: 129,657,458 M85V probably benign Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Nsl1 T C 1: 191,082,184 L194P probably damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp385c G A 11: 100,629,956 P293S probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Ncoa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ncoa3 APN 2 166051609 splice site probably null
IGL01068:Ncoa3 APN 2 166052795 missense probably damaging 1.00
IGL01300:Ncoa3 APN 2 166068461 missense probably benign 0.41
IGL01336:Ncoa3 APN 2 166054523 missense probably benign
IGL01533:Ncoa3 APN 2 166055025 missense probably benign 0.03
IGL01658:Ncoa3 APN 2 166051302 splice site probably benign
IGL02053:Ncoa3 APN 2 166054834 missense probably damaging 1.00
IGL02138:Ncoa3 APN 2 166055262 missense probably benign
IGL02167:Ncoa3 APN 2 166070136 missense probably damaging 1.00
IGL02217:Ncoa3 APN 2 166055346 missense probably damaging 1.00
IGL02312:Ncoa3 APN 2 166057200 missense probably benign 0.10
IGL02381:Ncoa3 APN 2 166052817 missense probably damaging 1.00
IGL02568:Ncoa3 APN 2 166069357 missense probably damaging 1.00
IGL02658:Ncoa3 APN 2 166051393 missense probably benign 0.01
IGL02806:Ncoa3 APN 2 166052432 missense probably benign 0.25
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0333:Ncoa3 UTSW 2 166054291 missense probably damaging 1.00
R0379:Ncoa3 UTSW 2 166054502 missense probably damaging 0.97
R0411:Ncoa3 UTSW 2 166068543 missense probably benign 0.31
R0734:Ncoa3 UTSW 2 166069191 unclassified probably benign
R1434:Ncoa3 UTSW 2 166055510 missense probably benign 0.01
R1491:Ncoa3 UTSW 2 166055262 missense probably benign
R1721:Ncoa3 UTSW 2 166069301 missense possibly damaging 0.55
R1895:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R1896:Ncoa3 UTSW 2 166048464 missense probably benign 0.36
R1946:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R2406:Ncoa3 UTSW 2 166055359 missense probably damaging 1.00
R3800:Ncoa3 UTSW 2 166059719 missense possibly damaging 0.58
R3825:Ncoa3 UTSW 2 166054798 missense possibly damaging 0.83
R4377:Ncoa3 UTSW 2 166054497 missense possibly damaging 0.50
R4674:Ncoa3 UTSW 2 166059811 missense probably benign
R4706:Ncoa3 UTSW 2 166047879 missense probably damaging 1.00
R4751:Ncoa3 UTSW 2 166069903 missense possibly damaging 0.81
R4954:Ncoa3 UTSW 2 166065786 missense probably benign
R4976:Ncoa3 UTSW 2 166047900 missense probably damaging 1.00
R4992:Ncoa3 UTSW 2 166069939 missense probably benign 0.39
R5100:Ncoa3 UTSW 2 166050097 missense probably damaging 1.00
R5578:Ncoa3 UTSW 2 166054328 missense probably benign 0.00
R5932:Ncoa3 UTSW 2 166070125 splice site probably null
R6051:Ncoa3 UTSW 2 166058765 missense probably damaging 1.00
R6370:Ncoa3 UTSW 2 166065905 missense probably benign 0.00
R6372:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R6373:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
X0018:Ncoa3 UTSW 2 166054802 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TCAGTGTGTCAGTCAAACAGCAGAG -3'
(R):5'- TTTGGCAAGCACATCACTGGGG -3'

Sequencing Primer
(F):5'- CAGCAGAGATCACCCAAGTG -3'
(R):5'- AGCACATCACTGGGGTCATC -3'
Posted On2013-05-23