Incidental Mutation 'R0054:Cgn'
ID40968
Institutional Source Beutler Lab
Gene Symbol Cgn
Ensembl Gene ENSMUSG00000068876
Gene Namecingulin
Synonyms6330408J11Rik
MMRRC Submission 038348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94760069-94786492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94762592 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1080 (D1080E)
Ref Sequence ENSEMBL: ENSMUSP00000102894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107272] [ENSMUST00000107273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107272
AA Change: D1072E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102893
Gene: ENSMUSG00000068876
AA Change: D1072E

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.06e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.06e-5 PROSPERO
low complexity region 446 462 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
low complexity region 536 549 N/A INTRINSIC
low complexity region 567 592 N/A INTRINSIC
low complexity region 660 676 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
Pfam:Myosin_tail_1 783 1140 3.4e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107273
AA Change: D1080E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102894
Gene: ENSMUSG00000068876
AA Change: D1080E

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.83e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.83e-5 PROSPERO
low complexity region 454 470 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 668 684 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
Pfam:Myosin_tail_1 799 1144 2.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118050
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to the ulcerogenic action of cysteamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cdh17 A G 4: 11,785,186 Y326C possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Farsb T A 1: 78,462,374 K395* probably null Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gphn A G 12: 78,637,503 S558G probably damaging Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kpna6 T C 4: 129,657,458 M85V probably benign Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Ncoa3 A G 2: 166,055,178 T630A possibly damaging Het
Nsl1 T C 1: 191,082,184 L194P probably damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp385c G A 11: 100,629,956 P293S probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Cgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cgn APN 3 94765548 missense probably benign 0.00
IGL00823:Cgn APN 3 94767209 missense probably damaging 1.00
IGL01349:Cgn APN 3 94767176 nonsense probably null
IGL01433:Cgn APN 3 94779459 missense probably damaging 0.99
IGL01467:Cgn APN 3 94779588 missense probably damaging 1.00
IGL01781:Cgn APN 3 94773205 missense probably benign
IGL01789:Cgn APN 3 94776218 missense possibly damaging 0.63
IGL01879:Cgn APN 3 94774364 nonsense probably null
IGL02805:Cgn APN 3 94774377 missense probably damaging 0.96
IGL02814:Cgn APN 3 94774240 missense probably benign 0.00
IGL02926:Cgn APN 3 94778016 missense probably benign 0.01
IGL03113:Cgn APN 3 94779234 missense probably benign
IGL03340:Cgn APN 3 94778095 intron probably benign
R0310:Cgn UTSW 3 94765653 missense possibly damaging 0.88
R0355:Cgn UTSW 3 94774932 missense probably benign
R0615:Cgn UTSW 3 94770714 unclassified probably benign
R0656:Cgn UTSW 3 94774894 unclassified probably benign
R1491:Cgn UTSW 3 94763228 missense probably damaging 1.00
R1509:Cgn UTSW 3 94774258 missense probably benign 0.00
R1794:Cgn UTSW 3 94762557 critical splice donor site probably null
R2113:Cgn UTSW 3 94779806 missense probably damaging 1.00
R3121:Cgn UTSW 3 94778482 splice site probably benign
R4655:Cgn UTSW 3 94779249 nonsense probably null
R4703:Cgn UTSW 3 94776095 utr 3 prime probably benign
R4714:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4715:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4959:Cgn UTSW 3 94778254 missense probably benign 0.06
R4973:Cgn UTSW 3 94778254 missense probably benign 0.06
R4995:Cgn UTSW 3 94779936 missense probably damaging 1.00
R5011:Cgn UTSW 3 94776145 missense probably null 1.00
R5329:Cgn UTSW 3 94779990 start codon destroyed probably null 0.02
R5524:Cgn UTSW 3 94779989 start codon destroyed probably null 0.56
R5695:Cgn UTSW 3 94773635 missense probably benign 0.00
R5839:Cgn UTSW 3 94774393 missense probably damaging 0.99
R5987:Cgn UTSW 3 94779522 missense probably benign 0.00
R6146:Cgn UTSW 3 94767125 missense possibly damaging 0.94
R6311:Cgn UTSW 3 94778176 intron probably benign
R6948:Cgn UTSW 3 94773221 missense probably benign 0.06
R7038:Cgn UTSW 3 94763085 missense possibly damaging 0.80
R7231:Cgn UTSW 3 94773192 missense probably damaging 0.99
R7251:Cgn UTSW 3 94776199 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGGGACCTCCCTTGCAATGACTC -3'
(R):5'- ATCTACTGGTGACGCTCAGGACAG -3'

Sequencing Primer
(F):5'- aagcatagaatctaagttcaatctcc -3'
(R):5'- TGACGCTCAGGACAGAGATG -3'
Posted On2013-05-23