Incidental Mutation 'R0054:Kpna6'
ID40977
Institutional Source Beutler Lab
Gene Symbol Kpna6
Ensembl Gene ENSMUSG00000003731
Gene Namekaryopherin (importin) alpha 6
SynonymsIPOA7, NPI-2
MMRRC Submission 038348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129643980-129672767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129657458 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 85 (M85V)
Ref Sequence ENSEMBL: ENSMUSP00000114265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003828] [ENSMUST00000102590] [ENSMUST00000126010]
Predicted Effect probably benign
Transcript: ENSMUST00000003828
AA Change: M85V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003828
Gene: ENSMUSG00000003731
AA Change: M85V

DomainStartEndE-ValueType
Pfam:IBB 2 100 9.5e-28 PFAM
ARM 109 151 2.46e-4 SMART
ARM 153 193 6.73e-11 SMART
ARM 195 236 3.19e-3 SMART
ARM 239 278 6.64e-1 SMART
ARM 280 320 1.16e-5 SMART
ARM 322 362 1.98e-8 SMART
ARM 364 404 6.68e-6 SMART
ARM 407 447 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102590
AA Change: M88V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099650
Gene: ENSMUSG00000003731
AA Change: M88V

DomainStartEndE-ValueType
Pfam:IBB 9 102 4.4e-27 PFAM
ARM 112 154 2.46e-4 SMART
ARM 156 196 6.73e-11 SMART
ARM 198 239 3.19e-3 SMART
ARM 242 281 6.64e-1 SMART
ARM 283 323 1.16e-5 SMART
ARM 325 365 1.98e-8 SMART
ARM 367 407 6.68e-6 SMART
ARM 410 450 1.89e-5 SMART
Pfam:Arm_3 464 514 5.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126010
AA Change: M85V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114265
Gene: ENSMUSG00000003731
AA Change: M85V

DomainStartEndE-ValueType
Pfam:IBB 2 88 3.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146361
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. The protein encoded by this gene is a member of the importin alpha family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null mutation are infertile and show a block in zygotic genome activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cdh17 A G 4: 11,785,186 Y326C possibly damaging Het
Cgn A T 3: 94,762,592 D1080E possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Farsb T A 1: 78,462,374 K395* probably null Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gphn A G 12: 78,637,503 S558G probably damaging Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Ncoa3 A G 2: 166,055,178 T630A possibly damaging Het
Nsl1 T C 1: 191,082,184 L194P probably damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp385c G A 11: 100,629,956 P293S probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Kpna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Kpna6 APN 4 129655483 missense probably damaging 1.00
IGL02750:Kpna6 APN 4 129661377 missense probably damaging 1.00
IGL02904:Kpna6 APN 4 129650687 missense probably benign 0.24
IGL02998:Kpna6 APN 4 129655504 missense probably benign 0.00
IGL03370:Kpna6 APN 4 129655521 missense probably damaging 1.00
krazy_eight UTSW 4 129655428 critical splice donor site probably null
magnificent_seven UTSW 4 129649306 nonsense probably null
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0305:Kpna6 UTSW 4 129649249 missense probably benign 0.00
R0390:Kpna6 UTSW 4 129657804 missense possibly damaging 0.61
R0623:Kpna6 UTSW 4 129655416 unclassified probably benign
R0646:Kpna6 UTSW 4 129650790 missense probably benign 0.43
R1067:Kpna6 UTSW 4 129648103 missense probably benign 0.39
R1348:Kpna6 UTSW 4 129661359 nonsense probably null
R1661:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1665:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1766:Kpna6 UTSW 4 129657442 missense probably benign 0.33
R4833:Kpna6 UTSW 4 129657779 missense possibly damaging 0.51
R4941:Kpna6 UTSW 4 129648032 missense probably damaging 1.00
R4974:Kpna6 UTSW 4 129656405 splice site probably null
R5244:Kpna6 UTSW 4 129655428 critical splice donor site probably null
R5914:Kpna6 UTSW 4 129672692 unclassified probably benign
R6148:Kpna6 UTSW 4 129649306 nonsense probably null
R6713:Kpna6 UTSW 4 129653984 missense probably damaging 1.00
R6799:Kpna6 UTSW 4 129657454 missense probably damaging 0.99
R6942:Kpna6 UTSW 4 129651721 splice site probably null
R7073:Kpna6 UTSW 4 129654346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCAAGGTAGGATGAGCAAT -3'
(R):5'- GGAAGCTCTTCTGTGCCTTCTGTG -3'

Sequencing Primer
(F):5'- tggggggagggtataggg -3'
(R):5'- TTCTGTGGACAATCCACCAG -3'
Posted On2013-05-23