Incidental Mutation 'R0054:Zfp385c'
ID41007
Institutional Source Beutler Lab
Gene Symbol Zfp385c
Ensembl Gene ENSMUSG00000014198
Gene Namezinc finger protein 385C
SynonymsA930006D11Rik
MMRRC Submission 038348-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100627543-100692455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100629956 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 293 (P293S)
Ref Sequence ENSEMBL: ENSMUSP00000099408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017981] [ENSMUST00000051947] [ENSMUST00000103119] [ENSMUST00000107376] [ENSMUST00000142993]
Predicted Effect probably benign
Transcript: ENSMUST00000017981
SMART Domains Protein: ENSMUSP00000017981
Gene: ENSMUSG00000017837

DomainStartEndE-ValueType
Pfam:Arf 1 168 4.3e-9 PFAM
Pfam:Roc 6 124 2.2e-13 PFAM
Pfam:MMR_HSR1 6 165 3.1e-6 PFAM
Pfam:Ras 6 170 2.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051947
SMART Domains Protein: ENSMUSP00000059559
Gene: ENSMUSG00000017837

DomainStartEndE-ValueType
Pfam:Arf 1 168 5.6e-9 PFAM
Pfam:Miro 6 123 2.2e-21 PFAM
Pfam:Ras 6 170 4.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103119
AA Change: P293S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099408
Gene: ENSMUSG00000014198
AA Change: P293S

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
ZnF_U1 72 108 4.36e-2 SMART
ZnF_C2H2 77 99 1.51e0 SMART
low complexity region 125 141 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
ZnF_U1 225 259 5.72e-4 SMART
ZnF_C2H2 228 252 7.11e0 SMART
ZnF_U1 294 328 7.44e-3 SMART
ZnF_C2H2 297 321 4.34e0 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 382 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107376
SMART Domains Protein: ENSMUSP00000102999
Gene: ENSMUSG00000017837

DomainStartEndE-ValueType
Pfam:Arf 1 168 5.6e-9 PFAM
Pfam:Miro 6 123 2.2e-21 PFAM
Pfam:Ras 6 170 4.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142993
SMART Domains Protein: ENSMUSP00000114456
Gene: ENSMUSG00000017837

DomainStartEndE-ValueType
Pfam:Arf 1 151 1.3e-8 PFAM
Pfam:Miro 6 123 1.4e-21 PFAM
Pfam:MMR_HSR1 6 145 4.5e-6 PFAM
Pfam:Ras 6 153 2.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148560
Predicted Effect probably benign
Transcript: ENSMUST00000151589
SMART Domains Protein: ENSMUSP00000119259
Gene: ENSMUSG00000014198

DomainStartEndE-ValueType
ZnF_U1 40 74 6.04e-3 SMART
ZnF_C2H2 43 67 6.31e1 SMART
low complexity region 79 104 N/A INTRINSIC
ZnF_U1 152 188 4.36e-2 SMART
ZnF_C2H2 157 179 1.51e0 SMART
low complexity region 205 221 N/A INTRINSIC
low complexity region 223 241 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155840
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cdh17 A G 4: 11,785,186 Y326C possibly damaging Het
Cgn A T 3: 94,762,592 D1080E possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Farsb T A 1: 78,462,374 K395* probably null Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gphn A G 12: 78,637,503 S558G probably damaging Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kpna6 T C 4: 129,657,458 M85V probably benign Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Ncoa3 A G 2: 166,055,178 T630A possibly damaging Het
Nsl1 T C 1: 191,082,184 L194P probably damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Zfp385c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Zfp385c APN 11 100629019 missense probably damaging 1.00
IGL02542:Zfp385c APN 11 100629916 missense probably damaging 1.00
IGL02579:Zfp385c APN 11 100630779 missense probably damaging 1.00
IGL03243:Zfp385c APN 11 100634747 missense probably damaging 1.00
R0054:Zfp385c UTSW 11 100629956 missense probably benign 0.08
R1158:Zfp385c UTSW 11 100629883 unclassified probably benign
R1884:Zfp385c UTSW 11 100630706 missense probably benign
R1892:Zfp385c UTSW 11 100637804 missense probably damaging 1.00
R6010:Zfp385c UTSW 11 100657537 missense probably benign 0.00
R6020:Zfp385c UTSW 11 100632768 missense probably benign
R6901:Zfp385c UTSW 11 100632759 missense probably benign 0.06
R7008:Zfp385c UTSW 11 100630687 missense probably damaging 0.99
R7272:Zfp385c UTSW 11 100630039 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GTACCTTGAGAACACTCACAGCCAG -3'
(R):5'- TGGGAAGACAGAAGTCTGTGTGCC -3'

Sequencing Primer
(F):5'- gacagacagacagacagacag -3'
(R):5'- GGGGTAGCCAAGCTAACC -3'
Posted On2013-05-23