Incidental Mutation 'R0054:Slc17a3'
ID41012
Institutional Source Beutler Lab
Gene Symbol Slc17a3
Ensembl Gene ENSMUSG00000036083
Gene Namesolute carrier family 17 (sodium phosphate), member 3
SynonymsNpt4
MMRRC Submission 038348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23839434-23860716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23855858 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 293 (S293F)
Ref Sequence ENSEMBL: ENSMUSP00000131308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]
Predicted Effect probably damaging
Transcript: ENSMUST00000039721
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: S293F

DomainStartEndE-ValueType
Pfam:MFS_1 45 377 3.3e-46 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091698
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: S215F

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:MFS_1 95 293 2.8e-25 PFAM
transmembrane domain 310 332 N/A INTRINSIC
transmembrane domain 352 369 N/A INTRINSIC
transmembrane domain 379 398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110422
AA Change: S257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: S257F

DomainStartEndE-ValueType
Pfam:MFS_1 39 425 6.7e-47 PFAM
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166467
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: S293F

DomainStartEndE-ValueType
Pfam:MFS_1 9 338 2.3e-46 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cdh17 A G 4: 11,785,186 Y326C possibly damaging Het
Cgn A T 3: 94,762,592 D1080E possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Farsb T A 1: 78,462,374 K395* probably null Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gphn A G 12: 78,637,503 S558G probably damaging Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kpna6 T C 4: 129,657,458 M85V probably benign Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Ncoa3 A G 2: 166,055,178 T630A possibly damaging Het
Nsl1 T C 1: 191,082,184 L194P probably damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp385c G A 11: 100,629,956 P293S probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Slc17a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Slc17a3 APN 13 23856481 missense probably benign 0.20
IGL02569:Slc17a3 APN 13 23846302 missense probably damaging 1.00
IGL02628:Slc17a3 APN 13 23842451 start codon destroyed probably null 1.00
IGL02745:Slc17a3 APN 13 23842486 missense probably benign 0.01
IGL03001:Slc17a3 APN 13 23856784 missense probably damaging 1.00
IGL03143:Slc17a3 APN 13 23855979 splice site probably null
IGL03144:Slc17a3 APN 13 23846440 missense probably benign 0.00
R0052:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0152:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0153:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0233:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0234:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0257:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0294:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0295:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0318:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0319:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0352:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0462:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0610:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0627:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0652:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0765:Slc17a3 UTSW 13 23846896 nonsense probably null
R1529:Slc17a3 UTSW 13 23845445 missense probably damaging 1.00
R1532:Slc17a3 UTSW 13 23856500 missense probably damaging 1.00
R1569:Slc17a3 UTSW 13 23855608 missense probably benign 0.09
R1640:Slc17a3 UTSW 13 23852357 nonsense probably null
R1643:Slc17a3 UTSW 13 23857198 splice site probably benign
R1715:Slc17a3 UTSW 13 23856741 missense probably benign 0.19
R2407:Slc17a3 UTSW 13 23852435 critical splice donor site probably null
R2512:Slc17a3 UTSW 13 23846247 missense probably benign 0.13
R3923:Slc17a3 UTSW 13 23858054 missense possibly damaging 0.89
R4449:Slc17a3 UTSW 13 23856732 missense probably damaging 0.99
R5166:Slc17a3 UTSW 13 23842542 critical splice donor site probably null
R5748:Slc17a3 UTSW 13 23856466 missense probably damaging 1.00
R5989:Slc17a3 UTSW 13 23842428 start gained probably benign
R6281:Slc17a3 UTSW 13 23856799 missense probably benign 0.17
R6811:Slc17a3 UTSW 13 23855941 missense possibly damaging 0.61
R7283:Slc17a3 UTSW 13 23855848 missense
Predicted Primers PCR Primer
(F):5'- TGATTTATGATGACCCTGTCTCTCACCC -3'
(R):5'- ACTGTGACAGATGATGCAAACATGAAGA -3'

Sequencing Primer
(F):5'- TCTCTGAACCAACAGGTACATATAAG -3'
(R):5'- TGATGCAAACATGAAGAAGGAATG -3'
Posted On2013-05-23