Incidental Mutation 'R0066:Cep350'
ID41033
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 038357-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R0066 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 155911218 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 1421 (L1421R)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: L1421R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: L1421R

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fchsd2 A G 7: 101,278,424 Y691C possibly damaging Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Hnrnpd T C 5: 99,964,701 E222G probably damaging Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Npr2 G T 4: 43,632,329 V49L probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr736 T A 14: 50,393,202 F149I probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Rfx2 A T 17: 56,786,736 probably benign Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Tulp4 A T 17: 6,201,733 N60I probably damaging Het
Ubqlnl A T 7: 104,148,938 W451R probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTCAGTGTTAGGCACCCATTCCAG -3'
(R):5'- ACTCAGTCCCAGTTTAGAGAAGCGG -3'

Sequencing Primer
(F):5'- CCAGACGAGTTCTTAGTTATCCAGG -3'
(R):5'- GACCCATTAACTGTGAAATCCAGG -3'
Posted On2013-05-23