Incidental Mutation 'R0066:Npr2'
ID41054
Institutional Source Beutler Lab
Gene Symbol Npr2
Ensembl Gene ENSMUSG00000028469
Gene Namenatriuretic peptide receptor 2
Synonymspwe, cn, guanylyl cyclase-B
MMRRC Submission 038357-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R0066 (G1)
Quality Score184
Status Validated
Chromosome4
Chromosomal Location43631935-43651244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43632329 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 49 (V49L)
Ref Sequence ENSEMBL: ENSMUSP00000103506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000107874]
Predicted Effect probably benign
Transcript: ENSMUST00000030191
AA Change: V49L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: V49L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107874
AA Change: V49L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: V49L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174934
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Cep350 A C 1: 155,911,218 L1421R probably damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fchsd2 A G 7: 101,278,424 Y691C possibly damaging Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Hnrnpd T C 5: 99,964,701 E222G probably damaging Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr736 T A 14: 50,393,202 F149I probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Rfx2 A T 17: 56,786,736 probably benign Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Tulp4 A T 17: 6,201,733 N60I probably damaging Het
Ubqlnl A T 7: 104,148,938 W451R probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Npr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Npr2 APN 4 43641612 missense possibly damaging 0.51
IGL01116:Npr2 APN 4 43640248 missense probably damaging 0.99
IGL01447:Npr2 APN 4 43640554 missense possibly damaging 0.93
IGL02412:Npr2 APN 4 43647005 missense probably damaging 0.97
IGL02449:Npr2 APN 4 43646641 missense probably damaging 1.00
IGL03120:Npr2 APN 4 43643133 missense probably damaging 0.99
IGL03351:Npr2 APN 4 43640652 missense probably benign 0.36
R0201:Npr2 UTSW 4 43641617 missense probably damaging 0.98
R0309:Npr2 UTSW 4 43640904 unclassified probably benign
R0437:Npr2 UTSW 4 43648082 missense probably damaging 1.00
R0440:Npr2 UTSW 4 43650315 missense probably damaging 0.99
R0464:Npr2 UTSW 4 43640597 unclassified probably null
R0511:Npr2 UTSW 4 43632801 missense probably benign 0.00
R0576:Npr2 UTSW 4 43640947 missense probably benign 0.01
R0630:Npr2 UTSW 4 43641219 missense probably benign 0.18
R0690:Npr2 UTSW 4 43646991 missense probably damaging 0.98
R1079:Npr2 UTSW 4 43643654 missense probably damaging 1.00
R1140:Npr2 UTSW 4 43648353 missense possibly damaging 0.87
R1171:Npr2 UTSW 4 43647260 missense possibly damaging 0.52
R1741:Npr2 UTSW 4 43643350 missense probably damaging 1.00
R1848:Npr2 UTSW 4 43632384 missense probably benign
R1864:Npr2 UTSW 4 43641258 missense probably benign 0.30
R1919:Npr2 UTSW 4 43640578 missense probably damaging 1.00
R2054:Npr2 UTSW 4 43646560 missense probably damaging 0.99
R2106:Npr2 UTSW 4 43644329 missense probably damaging 1.00
R2143:Npr2 UTSW 4 43648166 missense probably damaging 1.00
R2306:Npr2 UTSW 4 43633609 missense probably damaging 1.00
R2372:Npr2 UTSW 4 43650432 missense probably damaging 1.00
R2889:Npr2 UTSW 4 43641600 missense probably benign 0.26
R3076:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3078:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3711:Npr2 UTSW 4 43643378 missense probably benign 0.00
R3730:Npr2 UTSW 4 43640999 missense possibly damaging 0.93
R4301:Npr2 UTSW 4 43641332 critical splice donor site probably null
R4352:Npr2 UTSW 4 43646592 missense probably damaging 1.00
R4412:Npr2 UTSW 4 43644150 missense probably damaging 0.99
R4583:Npr2 UTSW 4 43633522 splice site probably null
R4593:Npr2 UTSW 4 43647323 unclassified probably benign
R5042:Npr2 UTSW 4 43647002 missense probably damaging 1.00
R5213:Npr2 UTSW 4 43640673 critical splice donor site probably null
R5546:Npr2 UTSW 4 43650150 missense probably damaging 1.00
R5784:Npr2 UTSW 4 43632801 missense probably benign 0.00
R5787:Npr2 UTSW 4 43633593 missense possibly damaging 0.69
R6364:Npr2 UTSW 4 43643622 missense probably damaging 1.00
R6925:Npr2 UTSW 4 43647553 missense probably damaging 1.00
R6949:Npr2 UTSW 4 43640597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGTATCCGGGCCGACTAAGC -3'
(R):5'- AAGACGCCCTCGATGGTGAAGTAG -3'

Sequencing Primer
(F):5'- TGCCCAGTAGGCCAGAG -3'
(R):5'- AGCTGTCCAATTGAAGTGCC -3'
Posted On2013-05-23