Incidental Mutation 'R0066:Hnrnpd'
ID41059
Institutional Source Beutler Lab
Gene Symbol Hnrnpd
Ensembl Gene ENSMUSG00000000568
Gene Nameheterogeneous nuclear ribonucleoprotein D
SynonymsAuf1, Hnrpd
MMRRC Submission 038357-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R0066 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location99955935-99978938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99964701 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 222 (E222G)
Ref Sequence ENSEMBL: ENSMUSP00000072533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019128] [ENSMUST00000072750] [ENSMUST00000112939] [ENSMUST00000164833] [ENSMUST00000168396] [ENSMUST00000170912] [ENSMUST00000171640] [ENSMUST00000171786] [ENSMUST00000172361]
Predicted Effect probably damaging
Transcript: ENSMUST00000019128
AA Change: E241G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019128
Gene: ENSMUSG00000000568
AA Change: E241G

DomainStartEndE-ValueType
Pfam:CBFNT 1 79 1.3e-16 PFAM
RRM 98 170 3.85e-25 SMART
RRM 183 255 7.76e-21 SMART
low complexity region 262 268 N/A INTRINSIC
low complexity region 270 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072750
AA Change: E222G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072533
Gene: ENSMUSG00000000568
AA Change: E222G

DomainStartEndE-ValueType
low complexity region 7 66 N/A INTRINSIC
RRM 79 151 3.85e-25 SMART
RRM 164 236 7.76e-21 SMART
low complexity region 243 249 N/A INTRINSIC
low complexity region 251 270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112939
AA Change: E222G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108561
Gene: ENSMUSG00000000568
AA Change: E222G

DomainStartEndE-ValueType
low complexity region 7 66 N/A INTRINSIC
RRM 79 151 3.85e-25 SMART
RRM 164 236 7.76e-21 SMART
low complexity region 243 249 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 272 321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164833
AA Change: E17G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131785
Gene: ENSMUSG00000000568
AA Change: E17G

DomainStartEndE-ValueType
Blast:RRM 1 31 3e-13 BLAST
PDB:1X0F|A 1 35 1e-17 PDB
SCOP:d1fj7a_ 1 40 4e-4 SMART
low complexity region 46 61 N/A INTRINSIC
low complexity region 67 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168396
SMART Domains Protein: ENSMUSP00000131859
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
Pfam:CBFNT 1 79 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170654
Predicted Effect probably benign
Transcript: ENSMUST00000170912
Predicted Effect unknown
Transcript: ENSMUST00000171106
AA Change: E150G
SMART Domains Protein: ENSMUSP00000131262
Gene: ENSMUSG00000000568
AA Change: E150G

DomainStartEndE-ValueType
RRM 8 80 3.85e-25 SMART
RRM 93 165 7.76e-21 SMART
low complexity region 172 178 N/A INTRINSIC
low complexity region 180 199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171640
AA Change: E85G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127833
Gene: ENSMUSG00000000568
AA Change: E85G

DomainStartEndE-ValueType
RRM 27 99 7.76e-21 SMART
low complexity region 106 112 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171786
SMART Domains Protein: ENSMUSP00000125984
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
RRM 1 72 8.44e-22 SMART
internal_repeat_1 86 107 2.75e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000172361
AA Change: E241G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132735
Gene: ENSMUSG00000000568
AA Change: E241G

DomainStartEndE-ValueType
Pfam:CBFNT 1 78 9.6e-16 PFAM
RRM 98 170 3.85e-25 SMART
RRM 183 255 7.76e-21 SMART
low complexity region 262 268 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
low complexity region 291 340 N/A INTRINSIC
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are nucleic acid binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It localizes to both the nucleus and the cytoplasm. This protein is implicated in the regulation of mRNA stability. Alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in fetal growth retardation and decreased body weight. Mice show increased susceptibility to bacterial infection and endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Cep350 A C 1: 155,911,218 L1421R probably damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fchsd2 A G 7: 101,278,424 Y691C possibly damaging Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Npr2 G T 4: 43,632,329 V49L probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr736 T A 14: 50,393,202 F149I probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Rfx2 A T 17: 56,786,736 probably benign Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Tulp4 A T 17: 6,201,733 N60I probably damaging Het
Ubqlnl A T 7: 104,148,938 W451R probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Hnrnpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0066:Hnrnpd UTSW 5 99964701 missense probably damaging 1.00
R1022:Hnrnpd UTSW 5 99966157 makesense probably null
R1024:Hnrnpd UTSW 5 99966157 makesense probably null
R6019:Hnrnpd UTSW 5 99967236 missense probably benign 0.00
R6502:Hnrnpd UTSW 5 99966166 missense probably damaging 1.00
R6785:Hnrnpd UTSW 5 99978424 missense probably benign 0.12
R6937:Hnrnpd UTSW 5 99963770 missense probably benign 0.08
R7080:Hnrnpd UTSW 5 99976533 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCATGCTTGCCTAAGACCTAATAAC -3'
(R):5'- AGTCTGCCTTGCTTCTCTTAAAATGACC -3'

Sequencing Primer
(F):5'- tgacatacacctttaatcttagcac -3'
(R):5'- GTGCTACCTTCCCTGTAGTATATAAG -3'
Posted On2013-05-23