Incidental Mutation 'R0066:Fchsd2'
ID41075
Institutional Source Beutler Lab
Gene Symbol Fchsd2
Ensembl Gene ENSMUSG00000030691
Gene NameFCH and double SH3 domains 2
SynonymsSh3md3
MMRRC Submission 038357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0066 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101092863-101284405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101278424 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 691 (Y691C)
Ref Sequence ENSEMBL: ENSMUSP00000032931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032931] [ENSMUST00000098250] [ENSMUST00000207740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032931
AA Change: Y691C

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032931
Gene: ENSMUSG00000030691
AA Change: Y691C

DomainStartEndE-ValueType
Pfam:FCH 21 103 1.3e-22 PFAM
coiled coil region 379 421 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
SH3 496 553 2.39e-14 SMART
low complexity region 554 569 N/A INTRINSIC
SH3 594 652 1.22e-20 SMART
low complexity region 676 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098250
AA Change: Y667C

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095850
Gene: ENSMUSG00000030691
AA Change: Y667C

DomainStartEndE-ValueType
Pfam:FCH 12 108 3.6e-23 PFAM
coiled coil region 355 397 N/A INTRINSIC
low complexity region 442 450 N/A INTRINSIC
SH3 472 529 2.39e-14 SMART
low complexity region 530 545 N/A INTRINSIC
SH3 570 628 1.22e-20 SMART
low complexity region 652 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207740
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Cep350 A C 1: 155,911,218 L1421R probably damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Hnrnpd T C 5: 99,964,701 E222G probably damaging Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Npr2 G T 4: 43,632,329 V49L probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr736 T A 14: 50,393,202 F149I probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Rfx2 A T 17: 56,786,736 probably benign Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Tulp4 A T 17: 6,201,733 N60I probably damaging Het
Ubqlnl A T 7: 104,148,938 W451R probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Fchsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Fchsd2 APN 7 101271622 missense probably benign 0.26
IGL00910:Fchsd2 APN 7 101277626 missense probably benign 0.00
IGL02065:Fchsd2 APN 7 101177222 critical splice donor site probably null
IGL02545:Fchsd2 APN 7 101198508 missense probably benign
IGL02651:Fchsd2 APN 7 101277600 missense possibly damaging 0.60
IGL03286:Fchsd2 APN 7 101259775 critical splice donor site probably null
IGL03333:Fchsd2 APN 7 101198496 missense probably damaging 0.97
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0668:Fchsd2 UTSW 7 101196920 missense possibly damaging 0.63
R1281:Fchsd2 UTSW 7 101253552 missense possibly damaging 0.92
R1868:Fchsd2 UTSW 7 101250438 splice site probably benign
R1996:Fchsd2 UTSW 7 101278453 missense probably benign 0.00
R2024:Fchsd2 UTSW 7 101198533 missense possibly damaging 0.81
R2060:Fchsd2 UTSW 7 101277417 missense probably benign
R2243:Fchsd2 UTSW 7 101233885 missense probably benign 0.30
R3419:Fchsd2 UTSW 7 101278660 splice site probably null
R3898:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3899:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3900:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R4496:Fchsd2 UTSW 7 101282495 missense probably benign 0.09
R4569:Fchsd2 UTSW 7 101277602 missense possibly damaging 0.60
R4667:Fchsd2 UTSW 7 101250449 missense probably damaging 1.00
R5408:Fchsd2 UTSW 7 101271574 missense possibly damaging 0.82
R5449:Fchsd2 UTSW 7 101277524 missense probably damaging 1.00
R5543:Fchsd2 UTSW 7 101271699 missense probably damaging 1.00
R5665:Fchsd2 UTSW 7 101110784 missense possibly damaging 0.50
R5894:Fchsd2 UTSW 7 101191752 missense probably benign 0.08
R5936:Fchsd2 UTSW 7 101191701 missense probably damaging 1.00
R6243:Fchsd2 UTSW 7 101271809 critical splice acceptor site probably benign
R6244:Fchsd2 UTSW 7 101259776 splice site probably null
R6247:Fchsd2 UTSW 7 101253540 missense probably benign
R6932:Fchsd2 UTSW 7 101277414 nonsense probably null
R7250:Fchsd2 UTSW 7 101259685 missense possibly damaging 0.61
X0028:Fchsd2 UTSW 7 101110804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTCCAGCAGACATGACAGATGG -3'
(R):5'- TCCTGGTGATTCAGCATGAAGGC -3'

Sequencing Primer
(F):5'- ACAGACTTAACTGACTTGCCTG -3'
(R):5'- CTGTTTTCTGAGGAAGAGAATCC -3'
Posted On2013-05-23