Incidental Mutation 'R0066:Nwd1'
ID41080
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene NameNACHT and WD repeat domain containing 1
SynonymsA230063L24Rik
MMRRC Submission 038357-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R0066 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72646711-72717876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72711856 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1552 (S1552T)
Ref Sequence ENSEMBL: ENSMUSP00000154488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
Predicted Effect probably benign
Transcript: ENSMUST00000093427
AA Change: S1553T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: S1553T

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably benign
Transcript: ENSMUST00000161254
AA Change: S1511T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: S1511T

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect probably benign
Transcript: ENSMUST00000228312
AA Change: S1552T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Cep350 A C 1: 155,911,218 L1421R probably damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fchsd2 A G 7: 101,278,424 Y691C possibly damaging Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Hnrnpd T C 5: 99,964,701 E222G probably damaging Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Npr2 G T 4: 43,632,329 V49L probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr736 T A 14: 50,393,202 F149I probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Rfx2 A T 17: 56,786,736 probably benign Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Tulp4 A T 17: 6,201,733 N60I probably damaging Het
Ubqlnl A T 7: 104,148,938 W451R probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 72671077 missense probably damaging 0.99
IGL01294:Nwd1 APN 8 72711745 missense probably damaging 1.00
IGL01298:Nwd1 APN 8 72662331 missense probably benign 0.00
IGL01333:Nwd1 APN 8 72666811 missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 72675115 missense probably damaging 1.00
IGL02244:Nwd1 APN 8 72707582 missense probably damaging 1.00
IGL02579:Nwd1 APN 8 72707527 missense probably damaging 1.00
IGL02608:Nwd1 APN 8 72667375 missense probably damaging 1.00
IGL02632:Nwd1 APN 8 72667454 missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 72667501 missense probably damaging 1.00
IGL03010:Nwd1 APN 8 72688060 splice site probably benign
R0017:Nwd1 UTSW 8 72709425 splice site probably benign
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0505:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0511:Nwd1 UTSW 8 72682005 missense probably damaging 1.00
R0612:Nwd1 UTSW 8 72667680 missense probably damaging 0.99
R0681:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0763:Nwd1 UTSW 8 72671044 missense probably damaging 1.00
R0905:Nwd1 UTSW 8 72709449 missense probably damaging 0.99
R1136:Nwd1 UTSW 8 72697769 splice site probably benign
R1483:Nwd1 UTSW 8 72657086 missense probably damaging 0.96
R1630:Nwd1 UTSW 8 72667029 missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 72711620 missense probably damaging 1.00
R1732:Nwd1 UTSW 8 72666835 missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 72704994 missense probably benign 0.00
R1973:Nwd1 UTSW 8 72704962 missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 72662427 missense probably benign
R2926:Nwd1 UTSW 8 72667012 missense probably damaging 1.00
R3706:Nwd1 UTSW 8 72667116 missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 72667811 nonsense probably null
R3917:Nwd1 UTSW 8 72667811 nonsense probably null
R4153:Nwd1 UTSW 8 72681936 missense probably damaging 1.00
R4426:Nwd1 UTSW 8 72666795 missense probably damaging 1.00
R4435:Nwd1 UTSW 8 72688136 missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 72670951 missense probably damaging 1.00
R4622:Nwd1 UTSW 8 72667300 missense probably damaging 1.00
R4659:Nwd1 UTSW 8 72695321 missense probably benign 0.03
R4694:Nwd1 UTSW 8 72667330 missense probably damaging 1.00
R4837:Nwd1 UTSW 8 72657131 missense probably damaging 1.00
R4844:Nwd1 UTSW 8 72667114 missense probably damaging 1.00
R4906:Nwd1 UTSW 8 72672213 missense probably damaging 1.00
R5041:Nwd1 UTSW 8 72705055 missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 72671086 missense probably benign 0.07
R5416:Nwd1 UTSW 8 72666694 missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 72704976 missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5699:Nwd1 UTSW 8 72702974 critical splice donor site probably null
R5722:Nwd1 UTSW 8 72675244 missense probably damaging 0.97
R5762:Nwd1 UTSW 8 72670914 missense probably damaging 1.00
R5778:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5992:Nwd1 UTSW 8 72653573 critical splice donor site probably null
R6163:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6164:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6165:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6212:Nwd1 UTSW 8 72695322 missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 72662366 missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 72657062 missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 72682025 missense probably benign 0.27
R6944:Nwd1 UTSW 8 72653534 missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 72667660 missense probably damaging 1.00
R7060:Nwd1 UTSW 8 72666694 missense probably damaging 1.00
R7102:Nwd1 UTSW 8 72695329 missense not run
X0067:Nwd1 UTSW 8 72667256 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCTGTGATCAACCGAATCATCCC -3'
(R):5'- AGGCTGCTGCTCACTTGAAGGAAG -3'

Sequencing Primer
(F):5'- AATGGCTTCATGGCCCC -3'
(R):5'- TGCTCACTTGAAGGAAGTAGGC -3'
Posted On2013-05-23