Incidental Mutation 'R0066:Olfr736'
ID41111
Institutional Source Beutler Lab
Gene Symbol Olfr736
Ensembl Gene ENSMUSG00000047716
Gene Nameolfactory receptor 736
SynonymsMOR106-5, GA_x6K02T2PMLR-6089963-6090901
MMRRC Submission 038357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0066 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50381163-50394192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50393202 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 149 (F149I)
Ref Sequence ENSEMBL: ENSMUSP00000149654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058965] [ENSMUST00000213402] [ENSMUST00000213755] [ENSMUST00000215227] [ENSMUST00000215263]
Predicted Effect probably benign
Transcript: ENSMUST00000058965
AA Change: F149I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062700
Gene: ENSMUSG00000047716
AA Change: F149I

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 37 175 6.9e-7 PFAM
Pfam:7tm_1 43 294 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213402
AA Change: F149I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213755
AA Change: F149I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215227
AA Change: F149I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215263
AA Change: F149I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Cep350 A C 1: 155,911,218 L1421R probably damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fchsd2 A G 7: 101,278,424 Y691C possibly damaging Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Hnrnpd T C 5: 99,964,701 E222G probably damaging Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Npr2 G T 4: 43,632,329 V49L probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Rfx2 A T 17: 56,786,736 probably benign Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Tulp4 A T 17: 6,201,733 N60I probably damaging Het
Ubqlnl A T 7: 104,148,938 W451R probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Olfr736
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Olfr736 APN 14 50392834 missense probably benign 0.33
IGL01952:Olfr736 APN 14 50393403 missense probably benign 0.02
IGL01996:Olfr736 APN 14 50393659 missense probably damaging 0.99
IGL02694:Olfr736 APN 14 50392800 missense probably benign 0.02
IGL02717:Olfr736 APN 14 50393647 missense probably damaging 1.00
IGL03185:Olfr736 APN 14 50393398 missense probably damaging 0.99
IGL03218:Olfr736 APN 14 50393658 missense probably damaging 0.98
IGL03048:Olfr736 UTSW 14 50392788 missense possibly damaging 0.47
R0066:Olfr736 UTSW 14 50393202 missense probably benign 0.08
R0089:Olfr736 UTSW 14 50392864 missense probably benign
R0254:Olfr736 UTSW 14 50393079 missense probably damaging 0.99
R0284:Olfr736 UTSW 14 50392995 missense probably damaging 1.00
R1800:Olfr736 UTSW 14 50393329 nonsense probably null
R3885:Olfr736 UTSW 14 50392869 missense probably benign 0.05
R4302:Olfr736 UTSW 14 50393446 missense probably benign 0.23
R4452:Olfr736 UTSW 14 50392912 missense probably benign
R4705:Olfr736 UTSW 14 50392800 missense probably benign 0.02
R5340:Olfr736 UTSW 14 50393220 missense probably damaging 0.98
R6007:Olfr736 UTSW 14 50393491 missense probably damaging 1.00
R6338:Olfr736 UTSW 14 50393400 missense possibly damaging 0.47
R6358:Olfr736 UTSW 14 50393388 missense possibly damaging 0.78
R6521:Olfr736 UTSW 14 50393548 missense possibly damaging 0.95
R6527:Olfr736 UTSW 14 50393428 nonsense probably null
R6777:Olfr736 UTSW 14 50393658 missense probably damaging 0.98
R6903:Olfr736 UTSW 14 50393632 missense possibly damaging 0.48
X0026:Olfr736 UTSW 14 50393541 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTCCCTTGCCGCAGAGAAATACAG -3'
(R):5'- TGCCACAGATGAGAACAGTGCC -3'

Sequencing Primer
(F):5'- CTGATGTGCCAAACATGCTG -3'
(R):5'- CCTGGGATTGGGACACAGAC -3'
Posted On2013-05-23