Incidental Mutation 'R0097:Pign'
ID41134
Institutional Source Beutler Lab
Gene Symbol Pign
Ensembl Gene ENSMUSG00000056536
Gene Namephosphatidylinositol glycan anchor biosynthesis, class N
Synonyms
MMRRC Submission 038383-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock #R0097 (G1)
Quality Score205
Status Validated
Chromosome1
Chromosomal Location105518422-105663677 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 105587976 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]
Predicted Effect probably benign
Transcript: ENSMUST00000070699
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186485
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187537
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190811
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,412,480 I353K probably benign Het
5830473C10Rik T A 5: 90,584,936 S535R probably benign Het
Arfgap2 T A 2: 91,274,815 V422E probably benign Het
Baz1b T C 5: 135,198,259 S105P probably benign Het
Bbs10 T C 10: 111,298,844 V41A probably damaging Het
Cacna1s T A 1: 136,100,622 M899K possibly damaging Het
Ccnd2 G A 6: 127,146,052 A180V probably benign Het
Cldnd1 A G 16: 58,729,715 N87S possibly damaging Het
Cyp2c54 T A 19: 40,047,658 probably benign Het
Cyp2c54 G T 19: 40,047,659 probably benign Het
Dab2ip G A 2: 35,718,916 V629M possibly damaging Het
Ddx41 A T 13: 55,535,878 probably benign Het
Dmrta1 A T 4: 89,688,872 R188S probably benign Het
Eml3 T A 19: 8,936,651 F465L probably benign Het
Gm13128 T C 4: 144,331,287 S155P probably benign Het
Gm9938 T A 19: 23,724,464 probably benign Het
Gpr87 G A 3: 59,179,085 T333I probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Llgl2 T A 11: 115,844,497 Y59* probably null Het
Lzic A G 4: 149,488,076 E41G probably damaging Het
Mprip T A 11: 59,758,491 L1007Q possibly damaging Het
Mtfr2 T A 10: 20,348,376 S19T probably damaging Het
Mycbp2 A T 14: 103,155,762 M3121K probably damaging Het
Myocd T A 11: 65,179,014 M667L possibly damaging Het
Narfl T C 17: 25,777,002 S67P possibly damaging Het
Ncam2 A G 16: 81,517,537 D467G probably damaging Het
Neb T C 2: 52,204,894 N4882S probably damaging Het
Neu2 A G 1: 87,597,466 D391G probably benign Het
Nol4 C A 18: 22,719,141 A456S probably benign Het
Olfr1025-ps1 T C 2: 85,918,840 V305A probably benign Het
Padi6 C T 4: 140,730,957 V513M probably benign Het
Plpp2 T C 10: 79,530,537 E91G possibly damaging Het
Pnp T A 14: 50,951,416 V222D probably damaging Het
Pnp2 C T 14: 50,963,501 R148C probably benign Het
Prss38 A G 11: 59,375,608 L8S possibly damaging Het
Rab5b A T 10: 128,682,940 F108I probably damaging Het
Rbbp5 T A 1: 132,490,489 H15Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rsl1 A C 13: 67,181,902 Q138P probably damaging Het
Ryr3 T C 2: 112,800,055 D2157G probably damaging Het
Secisbp2l T C 2: 125,771,456 D206G probably damaging Het
Sh3pxd2b T A 11: 32,403,978 I182N probably damaging Het
Slc3a1 A T 17: 85,032,860 I237F probably damaging Het
Svs3b T C 2: 164,256,239 E54G probably damaging Het
T A T 17: 8,439,901 probably benign Het
Tenm4 A T 7: 96,892,926 D1882V probably damaging Het
Tgfbr1 T A 4: 47,403,451 L283* probably null Het
Tppp3 C T 8: 105,467,922 A149T probably benign Het
Ubp1 T C 9: 113,973,507 probably benign Het
Ushbp1 C T 8: 71,390,713 C314Y probably damaging Het
Vav2 A T 2: 27,299,362 probably benign Het
Vmn1r228 T C 17: 20,776,363 M298V probably benign Het
Zmpste24 A T 4: 121,095,543 probably benign Het
Other mutations in Pign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Pign APN 1 105597723 nonsense probably null
IGL00770:Pign APN 1 105597756 missense probably benign 0.00
IGL00774:Pign APN 1 105597756 missense probably benign 0.00
IGL00828:Pign APN 1 105554120 missense probably damaging 0.97
IGL01407:Pign APN 1 105589302 missense probably benign 0.06
IGL01523:Pign APN 1 105653178 missense probably damaging 0.98
IGL01953:Pign APN 1 105589039 splice site probably benign
IGL02389:Pign APN 1 105646781 nonsense probably null
PIT4810001:Pign UTSW 1 105597762 missense possibly damaging 0.83
R0080:Pign UTSW 1 105552405 missense probably damaging 1.00
R0302:Pign UTSW 1 105589093 missense possibly damaging 0.83
R0573:Pign UTSW 1 105653177 missense probably damaging 1.00
R0580:Pign UTSW 1 105591694 missense probably benign 0.03
R0946:Pign UTSW 1 105591697 missense probably benign 0.00
R1397:Pign UTSW 1 105657771 missense probably damaging 1.00
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1751:Pign UTSW 1 105653192 missense probably benign 0.19
R1753:Pign UTSW 1 105589317 missense possibly damaging 0.65
R1767:Pign UTSW 1 105653192 missense probably benign 0.19
R1854:Pign UTSW 1 105554498 missense probably damaging 0.99
R1907:Pign UTSW 1 105638215 missense possibly damaging 0.50
R2845:Pign UTSW 1 105657796 missense possibly damaging 0.80
R2846:Pign UTSW 1 105657796 missense possibly damaging 0.80
R3718:Pign UTSW 1 105649281 critical splice donor site probably null
R3970:Pign UTSW 1 105656003 missense probably damaging 1.00
R4067:Pign UTSW 1 105587978 critical splice donor site probably null
R4110:Pign UTSW 1 105553815 unclassified probably benign
R4387:Pign UTSW 1 105522060 missense possibly damaging 0.48
R4393:Pign UTSW 1 105522026 missense probably benign 0.00
R4472:Pign UTSW 1 105648220 missense probably benign 0.29
R4519:Pign UTSW 1 105597666 critical splice donor site probably null
R4619:Pign UTSW 1 105521990 utr 3 prime probably benign
R4746:Pign UTSW 1 105585024 missense probably benign 0.33
R4859:Pign UTSW 1 105648167 nonsense probably null
R4893:Pign UTSW 1 105646711 missense probably damaging 1.00
R4953:Pign UTSW 1 105644502 missense probably benign 0.32
R5046:Pign UTSW 1 105522073 missense possibly damaging 0.94
R5377:Pign UTSW 1 105657812 missense probably benign 0.12
R5388:Pign UTSW 1 105655970 missense probably damaging 1.00
R5482:Pign UTSW 1 105546710 missense probably benign 0.44
R5594:Pign UTSW 1 105646869 intron probably benign
R5639:Pign UTSW 1 105589315 missense probably benign 0.09
R5778:Pign UTSW 1 105591722 missense probably damaging 1.00
R5821:Pign UTSW 1 105589063 missense possibly damaging 0.95
R5928:Pign UTSW 1 105558067 missense possibly damaging 0.55
R5979:Pign UTSW 1 105589274 missense probably benign 0.01
R6213:Pign UTSW 1 105589266 missense possibly damaging 0.50
R6292:Pign UTSW 1 105585077 missense possibly damaging 0.69
R6343:Pign UTSW 1 105585095 missense probably benign 0.33
R6566:Pign UTSW 1 105638181 critical splice donor site probably null
R6856:Pign UTSW 1 105553895 nonsense probably null
R6954:Pign UTSW 1 105553897 missense probably benign 0.39
X0025:Pign UTSW 1 105657634 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TACTGCCTGTGAAGGTCTGGTAGC -3'
(R):5'- TCAGCCATGTACTGTGTGAGATGC -3'

Sequencing Primer
(F):5'- gtcagcagccaaacaatcc -3'
(R):5'- CATGTACTGTGTGAGATGCTAGAAAC -3'
Posted On2013-05-23