Incidental Mutation 'R0097:Ubp1'
ID41159
Institutional Source Beutler Lab
Gene Symbol Ubp1
Ensembl Gene ENSMUSG00000009741
Gene Nameupstream binding protein 1
SynonymsNF2d9, LBP-1b, LBP-1a
MMRRC Submission 038383-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0097 (G1)
Quality Score178
Status Validated
Chromosome9
Chromosomal Location113930934-113977202 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 113973507 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009885] [ENSMUST00000035090] [ENSMUST00000084885] [ENSMUST00000116492] [ENSMUST00000117537] [ENSMUST00000143180] [ENSMUST00000214095] [ENSMUST00000216558]
Predicted Effect probably benign
Transcript: ENSMUST00000009885
SMART Domains Protein: ENSMUSP00000009885
Gene: ENSMUSG00000009741

DomainStartEndE-ValueType
Pfam:CP2 37 259 1.6e-76 PFAM
SCOP:d1kw4a_ 333 381 5e-3 SMART
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035090
SMART Domains Protein: ENSMUSP00000035090
Gene: ENSMUSG00000032507

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084885
SMART Domains Protein: ENSMUSP00000081946
Gene: ENSMUSG00000009741

DomainStartEndE-ValueType
Pfam:CP2 42 257 3e-62 PFAM
SCOP:d1kw4a_ 369 417 6e-3 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116492
SMART Domains Protein: ENSMUSP00000112192
Gene: ENSMUSG00000009741

DomainStartEndE-ValueType
Pfam:CP2 37 259 1.6e-76 PFAM
SCOP:d1kw4a_ 333 381 5e-3 SMART
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117537
SMART Domains Protein: ENSMUSP00000114075
Gene: ENSMUSG00000032507

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143180
Predicted Effect probably benign
Transcript: ENSMUST00000214095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216293
Predicted Effect probably benign
Transcript: ENSMUST00000216558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216891
Meta Mutation Damage Score 0.0564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,412,480 I353K probably benign Het
5830473C10Rik T A 5: 90,584,936 S535R probably benign Het
Arfgap2 T A 2: 91,274,815 V422E probably benign Het
Baz1b T C 5: 135,198,259 S105P probably benign Het
Bbs10 T C 10: 111,298,844 V41A probably damaging Het
Cacna1s T A 1: 136,100,622 M899K possibly damaging Het
Ccnd2 G A 6: 127,146,052 A180V probably benign Het
Cldnd1 A G 16: 58,729,715 N87S possibly damaging Het
Cyp2c54 T A 19: 40,047,658 probably benign Het
Cyp2c54 G T 19: 40,047,659 probably benign Het
Dab2ip G A 2: 35,718,916 V629M possibly damaging Het
Ddx41 A T 13: 55,535,878 probably benign Het
Dmrta1 A T 4: 89,688,872 R188S probably benign Het
Eml3 T A 19: 8,936,651 F465L probably benign Het
Gm13128 T C 4: 144,331,287 S155P probably benign Het
Gm9938 T A 19: 23,724,464 probably benign Het
Gpr87 G A 3: 59,179,085 T333I probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Llgl2 T A 11: 115,844,497 Y59* probably null Het
Lzic A G 4: 149,488,076 E41G probably damaging Het
Mprip T A 11: 59,758,491 L1007Q possibly damaging Het
Mtfr2 T A 10: 20,348,376 S19T probably damaging Het
Mycbp2 A T 14: 103,155,762 M3121K probably damaging Het
Myocd T A 11: 65,179,014 M667L possibly damaging Het
Narfl T C 17: 25,777,002 S67P possibly damaging Het
Ncam2 A G 16: 81,517,537 D467G probably damaging Het
Neb T C 2: 52,204,894 N4882S probably damaging Het
Neu2 A G 1: 87,597,466 D391G probably benign Het
Nol4 C A 18: 22,719,141 A456S probably benign Het
Olfr1025-ps1 T C 2: 85,918,840 V305A probably benign Het
Padi6 C T 4: 140,730,957 V513M probably benign Het
Pign G A 1: 105,587,976 probably benign Het
Plpp2 T C 10: 79,530,537 E91G possibly damaging Het
Pnp T A 14: 50,951,416 V222D probably damaging Het
Pnp2 C T 14: 50,963,501 R148C probably benign Het
Prss38 A G 11: 59,375,608 L8S possibly damaging Het
Rab5b A T 10: 128,682,940 F108I probably damaging Het
Rbbp5 T A 1: 132,490,489 H15Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rsl1 A C 13: 67,181,902 Q138P probably damaging Het
Ryr3 T C 2: 112,800,055 D2157G probably damaging Het
Secisbp2l T C 2: 125,771,456 D206G probably damaging Het
Sh3pxd2b T A 11: 32,403,978 I182N probably damaging Het
Slc3a1 A T 17: 85,032,860 I237F probably damaging Het
Svs3b T C 2: 164,256,239 E54G probably damaging Het
T A T 17: 8,439,901 probably benign Het
Tenm4 A T 7: 96,892,926 D1882V probably damaging Het
Tgfbr1 T A 4: 47,403,451 L283* probably null Het
Tppp3 C T 8: 105,467,922 A149T probably benign Het
Ushbp1 C T 8: 71,390,713 C314Y probably damaging Het
Vav2 A T 2: 27,299,362 probably benign Het
Vmn1r228 T C 17: 20,776,363 M298V probably benign Het
Zmpste24 A T 4: 121,095,543 probably benign Het
Other mutations in Ubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Ubp1 APN 9 113956758 missense probably damaging 1.00
IGL01951:Ubp1 APN 9 113951618 nonsense probably null
R0097:Ubp1 UTSW 9 113973507 splice site probably benign
R0241:Ubp1 UTSW 9 113966587 critical splice donor site probably null
R0669:Ubp1 UTSW 9 113964668 splice site probably benign
R0709:Ubp1 UTSW 9 113944931 missense probably damaging 1.00
R1416:Ubp1 UTSW 9 113970171 missense probably benign 0.02
R1466:Ubp1 UTSW 9 113944835 splice site probably benign
R1753:Ubp1 UTSW 9 113955969 missense possibly damaging 0.74
R1780:Ubp1 UTSW 9 113964579 missense possibly damaging 0.84
R2235:Ubp1 UTSW 9 113964644 missense probably damaging 1.00
R3418:Ubp1 UTSW 9 113951686 critical splice donor site probably null
R3978:Ubp1 UTSW 9 113956705 critical splice acceptor site probably null
R4024:Ubp1 UTSW 9 113944883 missense probably benign 0.03
R4469:Ubp1 UTSW 9 113958707 missense probably benign 0.11
R4797:Ubp1 UTSW 9 113956002 missense probably damaging 1.00
R4984:Ubp1 UTSW 9 113959392 missense probably damaging 0.97
R5914:Ubp1 UTSW 9 113956739 missense probably benign 0.00
R6971:Ubp1 UTSW 9 113972763 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCTTTGCACACTGTTGGAAGAGC -3'
(R):5'- CTGAGCCCTTGTTTCATTCAAGCAC -3'

Sequencing Primer
(F):5'- GCTATGTTCACTGACAAGCAG -3'
(R):5'- GTTTCATTCAAGCACTACCAGGG -3'
Posted On2013-05-23