Incidental Mutation 'R0097:T'
ID41176
Institutional Source Beutler Lab
Gene Symbol T
Ensembl Gene ENSMUSG00000062327
Gene Namebrachyury, T-box transcription factor T
SynonymsBra, cou, Low, low ratio, Lr, me75, T1, Tl2, Tl3
MMRRC Submission 038383-MU
Accession Numbers

Genbank: NM_009309.2

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0097 (G1)
Quality Score169
Status Validated
Chromosome17
Chromosomal Location8434423-8442496 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 8439901 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074667] [ENSMUST00000136922] [ENSMUST00000177118]
Predicted Effect probably benign
Transcript: ENSMUST00000074667
SMART Domains Protein: ENSMUSP00000074236
Gene: ENSMUSG00000062327

DomainStartEndE-ValueType
TBOX 41 224 5.53e-120 SMART
low complexity region 391 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136922
SMART Domains Protein: ENSMUSP00000119581
Gene: ENSMUSG00000062327

DomainStartEndE-ValueType
TBOX 1 137 3.02e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177118
SMART Domains Protein: ENSMUSP00000135526
Gene: ENSMUSG00000062327

DomainStartEndE-ValueType
TBOX 1 82 3.3e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an embryonic nuclear transcription factor that binds to a specific DNA element, the palindromic T-site. It binds through a region in its N-terminus, called the T-box, and effects transcription of genes required for mesoderm formation and differentiation. The protein is localized to notochord-derived cells. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mice die during embryonice development. Heterozygous mice have skeletal abnormalities. On specific genetic backgrounds, some alleles cause partial or complete sex-reversal of chromosomally XY mice. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Targeted, other(2) Transgenic(1) Spontaneous(17) Chemically induced(10) Radiation induced(15)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,412,480 I353K probably benign Het
5830473C10Rik T A 5: 90,584,936 S535R probably benign Het
Arfgap2 T A 2: 91,274,815 V422E probably benign Het
Baz1b T C 5: 135,198,259 S105P probably benign Het
Bbs10 T C 10: 111,298,844 V41A probably damaging Het
Cacna1s T A 1: 136,100,622 M899K possibly damaging Het
Ccnd2 G A 6: 127,146,052 A180V probably benign Het
Cldnd1 A G 16: 58,729,715 N87S possibly damaging Het
Cyp2c54 T A 19: 40,047,658 probably benign Het
Cyp2c54 G T 19: 40,047,659 probably benign Het
Dab2ip G A 2: 35,718,916 V629M possibly damaging Het
Ddx41 A T 13: 55,535,878 probably benign Het
Dmrta1 A T 4: 89,688,872 R188S probably benign Het
Eml3 T A 19: 8,936,651 F465L probably benign Het
Gm13128 T C 4: 144,331,287 S155P probably benign Het
Gm9938 T A 19: 23,724,464 probably benign Het
Gpr87 G A 3: 59,179,085 T333I probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Llgl2 T A 11: 115,844,497 Y59* probably null Het
Lzic A G 4: 149,488,076 E41G probably damaging Het
Mprip T A 11: 59,758,491 L1007Q possibly damaging Het
Mtfr2 T A 10: 20,348,376 S19T probably damaging Het
Mycbp2 A T 14: 103,155,762 M3121K probably damaging Het
Myocd T A 11: 65,179,014 M667L possibly damaging Het
Narfl T C 17: 25,777,002 S67P possibly damaging Het
Ncam2 A G 16: 81,517,537 D467G probably damaging Het
Neb T C 2: 52,204,894 N4882S probably damaging Het
Neu2 A G 1: 87,597,466 D391G probably benign Het
Nol4 C A 18: 22,719,141 A456S probably benign Het
Olfr1025-ps1 T C 2: 85,918,840 V305A probably benign Het
Padi6 C T 4: 140,730,957 V513M probably benign Het
Pign G A 1: 105,587,976 probably benign Het
Plpp2 T C 10: 79,530,537 E91G possibly damaging Het
Pnp T A 14: 50,951,416 V222D probably damaging Het
Pnp2 C T 14: 50,963,501 R148C probably benign Het
Prss38 A G 11: 59,375,608 L8S possibly damaging Het
Rab5b A T 10: 128,682,940 F108I probably damaging Het
Rbbp5 T A 1: 132,490,489 H15Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rsl1 A C 13: 67,181,902 Q138P probably damaging Het
Ryr3 T C 2: 112,800,055 D2157G probably damaging Het
Secisbp2l T C 2: 125,771,456 D206G probably damaging Het
Sh3pxd2b T A 11: 32,403,978 I182N probably damaging Het
Slc3a1 A T 17: 85,032,860 I237F probably damaging Het
Svs3b T C 2: 164,256,239 E54G probably damaging Het
Tenm4 A T 7: 96,892,926 D1882V probably damaging Het
Tgfbr1 T A 4: 47,403,451 L283* probably null Het
Tppp3 C T 8: 105,467,922 A149T probably benign Het
Ubp1 T C 9: 113,973,507 probably benign Het
Ushbp1 C T 8: 71,390,713 C314Y probably damaging Het
Vav2 A T 2: 27,299,362 probably benign Het
Vmn1r228 T C 17: 20,776,363 M298V probably benign Het
Zmpste24 A T 4: 121,095,543 probably benign Het
Other mutations in T
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:T APN 17 8437165 missense probably benign 0.01
IGL01155:T APN 17 8441745 unclassified probably null
IGL02343:T APN 17 8439900 splice site probably benign
IGL02626:T APN 17 8435237 missense probably damaging 0.99
IGL02628:T APN 17 8435358 missense probably damaging 1.00
IGL02970:T APN 17 8435385 missense probably damaging 0.97
I2289:T UTSW 17 8438642 missense probably benign
R0097:T UTSW 17 8439901 splice site probably benign
R1164:T UTSW 17 8439939 missense probably benign 0.00
R1993:T UTSW 17 8441802 missense probably benign 0.00
R5148:T UTSW 17 8436205 missense probably damaging 1.00
R5423:T UTSW 17 8441765 missense probably damaging 1.00
R5710:T UTSW 17 8441642 missense probably benign 0.00
R6160:T UTSW 17 8441786 missense probably benign 0.00
R6196:T UTSW 17 8437164 missense possibly damaging 0.73
R6447:T UTSW 17 8441631 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCGGAATCGCCATTATGGAAAAGG -3'
(R):5'- CATGTCAAACCCATCAGCCTGAGAG -3'

Sequencing Primer
(F):5'- agcgtttgagaggctctg -3'
(R):5'- TGAGAGACACACACAGACTG -3'
Posted On2013-05-23