Incidental Mutation 'R0457:Hmcn2'
ID41190
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Namehemicentin 2
Synonyms
MMRRC Submission 038657-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock #R0457 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31314415-31460738 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 31415284 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
Predicted Effect probably null
Transcript: ENSMUST00000113532
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226996
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,274,545 S691P probably benign Het
Aspscr1 A G 11: 120,677,618 E12G probably benign Het
Atp2a2 T C 5: 122,469,714 Q244R probably benign Het
Birc6 A G 17: 74,652,028 M3818V probably benign Het
Birc6 C T 17: 74,662,625 A4230V probably damaging Het
Bub1b T C 2: 118,609,859 F148S probably damaging Het
C130079G13Rik A G 3: 59,936,633 I249M possibly damaging Het
C1ra T C 6: 124,522,753 S633P probably benign Het
Cacna2d1 A G 5: 16,267,416 T274A probably damaging Het
Cmya5 A G 13: 93,095,587 W998R possibly damaging Het
Crbn T C 6: 106,781,057 K404R probably benign Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Csmd1 C A 8: 16,501,393 probably null Het
Defa-ps1 A T 8: 21,695,742 noncoding transcript Het
Dnajc10 T A 2: 80,344,946 V559D possibly damaging Het
Dock1 A T 7: 135,138,145 E1423D possibly damaging Het
Dpf3 A T 12: 83,272,405 S44T probably damaging Het
Dyrk3 A T 1: 131,136,357 V31D possibly damaging Het
F5 T C 1: 164,194,200 S1415P probably benign Het
Fam186b A C 15: 99,271,285 I927S probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fer1l6 G A 15: 58,638,094 probably null Het
Fndc7 G T 3: 108,876,545 S249R probably benign Het
Ganab A G 19: 8,907,250 E139G possibly damaging Het
Gbp5 A G 3: 142,507,757 D478G probably damaging Het
Gm17324 T A 9: 78,448,298 M1K probably null Het
Gm996 G T 2: 25,578,346 R518S possibly damaging Het
Gtpbp6 T A 5: 110,106,742 R126S probably damaging Het
Hapln4 G A 8: 70,088,472 W385* probably null Het
Hsp90ab1 A G 17: 45,568,988 V534A probably damaging Het
Kat6b C A 14: 21,670,530 T1650K probably damaging Het
Kpna1 T A 16: 36,002,905 D42E probably benign Het
Lrrc14b A G 13: 74,361,160 M376T probably benign Het
Lrrc40 A G 3: 158,054,564 probably null Het
Ltv1 T C 10: 13,192,143 T34A probably benign Het
Mga T A 2: 119,916,488 N373K probably damaging Het
Msh3 A T 13: 92,220,997 M101K probably damaging Het
Mthfd2l T C 5: 91,020,206 M320T possibly damaging Het
Mug1 G A 6: 121,861,555 E506K probably benign Het
Ngb T C 12: 87,100,729 D54G probably damaging Het
Ntrk1 A G 3: 87,791,707 F84L probably benign Het
Olfr347 A T 2: 36,734,533 I71F probably benign Het
Olfr667 T A 7: 104,916,973 T108S probably benign Het
Phf12 T A 11: 78,018,168 I358N possibly damaging Het
Plec A G 15: 76,177,601 F2577S probably damaging Het
Polr1c T A 17: 46,247,763 Y36F probably benign Het
Prkd1 A T 12: 50,366,372 M672K probably damaging Het
Prob1 T C 18: 35,652,486 Y905C probably damaging Het
Ptpn23 T A 9: 110,386,293 H1433L possibly damaging Het
Rnf11 A T 4: 109,456,952 L80Q probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Scgb2b7 A T 7: 31,704,012 C90S possibly damaging Het
Slc4a9 T C 18: 36,535,418 L710P probably damaging Het
Spire1 T A 18: 67,552,600 I35F probably damaging Het
Sptbn2 T C 19: 4,745,938 V1715A possibly damaging Het
St7 T C 6: 17,819,282 F62L probably damaging Het
Svep1 C T 4: 58,118,136 G862D probably damaging Het
Syne1 A T 10: 5,022,041 M8789K probably damaging Het
Synpo2 A G 3: 123,112,772 L965P probably damaging Het
Trhde A T 10: 114,448,262 M772K probably benign Het
Ttn T A 2: 76,778,507 K15976* probably null Het
Unc13a A C 8: 71,658,001 probably null Het
Vcan T C 13: 89,703,199 E1214G possibly damaging Het
Vmn1r29 T C 6: 58,308,087 V264A probably benign Het
Vmn1r60 T A 7: 5,545,119 probably benign Het
Wdr90 C T 17: 25,860,485 R225H probably benign Het
Wnk1 G A 6: 119,969,332 T620I probably damaging Het
Zan C T 5: 137,407,706 probably benign Het
Zfp37 A T 4: 62,191,665 C387* probably null Het
Zfp521 T C 18: 13,844,840 T839A probably benign Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31343096 missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31428994 missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31383821 intron probably benign
IGL01364:Hmcn2 APN 2 31361814 nonsense probably null
IGL01486:Hmcn2 APN 2 31336621 missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31354264 missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31424252 missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31343102 missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31405630 missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31398917 missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31428982 missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31457173 missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31400127 missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31424377 missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31453605 missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31450952 missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31420095 missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31454811 missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31408973 missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31405528 missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31346590 missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31413367 nonsense probably null
IGL03003:Hmcn2 APN 2 31433486 missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31346630 missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31362230 missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31346621 missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31346637 missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31428250 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31388344 missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31426198 missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31438331 critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31369164 splice site probably benign
R0266:Hmcn2 UTSW 2 31394827 missense probably benign 0.03
R0266:Hmcn2 UTSW 2 31445353 splice site probably benign
R0326:Hmcn2 UTSW 2 31423225 nonsense probably null
R0366:Hmcn2 UTSW 2 31424206 missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31400129 missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31388247 missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31405612 missense probably damaging 1.00
R0487:Hmcn2 UTSW 2 31386677 missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31415236 missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31453160 missense probably damaging 0.99
R0811:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31391511 missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31346495 missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31314479 missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31420407 missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31430787 missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31458039 missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31450844 missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31354721 missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31457985 missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31396120 missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31314590 missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31393043 missense probably damaging 0.97
R1822:Hmcn2 UTSW 2 31383692 missense probably damaging 0.99
R1858:Hmcn2 UTSW 2 31415283 critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31411910 critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31389329 missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31438255 missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31335436 missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31378282 missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31380419 missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31333931 splice site probably benign
R2155:Hmcn2 UTSW 2 31460349 missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31380281 missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31419935 missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31380297 missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31350574 missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31335412 critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31388298 missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31460210 missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31360998 missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31400255 missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31433272 splice site probably benign
R3429:Hmcn2 UTSW 2 31409144 missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31336612 nonsense probably null
R3739:Hmcn2 UTSW 2 31336612 nonsense probably null
R3771:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31352885 splice site probably null
R3837:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31430350 missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31453157 missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31380484 critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31382394 missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31336612 nonsense probably null
R4057:Hmcn2 UTSW 2 31400238 missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31413265 missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31396710 missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31399019 missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31438285 missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31383775 missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31445314 missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31389391 missense possibly damaging 0.88
R4916:Hmcn2 UTSW 2 31360980 missense probably damaging 0.98
R4943:Hmcn2 UTSW 2 31335492 missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31354164 critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31344096 missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31393025 missense possibly damaging 0.88
R4994:Hmcn2 UTSW 2 31458055 critical splice donor site probably null
R4997:Hmcn2 UTSW 2 31401708 missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31409081 missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31458049 missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31389443 missense probably null
R5232:Hmcn2 UTSW 2 31457748 missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31414716 missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31430441 missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31409011 missense probably damaging 0.99
R5385:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5412:Hmcn2 UTSW 2 31346617 missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31336544 missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31420363 missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31406416 missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31393054 nonsense probably null
R5492:Hmcn2 UTSW 2 31420306 missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31414525 critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31414526 critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31344047 missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31428303 missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31333881 missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31420812 missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31336567 missense probably damaging 1.00
R5716:Hmcn2 UTSW 2 31458738 missense possibly damaging 0.68
R5725:Hmcn2 UTSW 2 31383815 critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31414568 missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31409135 missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31457807 missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31354673 missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31396139 missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31420323 missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31420309 missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31370792 missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31434713 missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31356254 missense probably benign
R6166:Hmcn2 UTSW 2 31369262 missense probably damaging 1.00
R6177:Hmcn2 UTSW 2 31420106 nonsense probably null
R6191:Hmcn2 UTSW 2 31458746 missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31384115 missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31411834 missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31388373 missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31369257 missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31420820 missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31361800 missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31425468 missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31382478 missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31356342 missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31415268 missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31343056 missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31350505 splice site probably null
R6971:Hmcn2 UTSW 2 31432321 missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31422649 missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31360896 missense probably benign 0.17
X0066:Hmcn2 UTSW 2 31454811 missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31405867 missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31459064 intron probably null
Z1088:Hmcn2 UTSW 2 31381067 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTGAATGAATCTGTGCCCCTCC -3'
(R):5'- TTAGAAAGGTCTGTGCTGCCCCTC -3'

Sequencing Primer
(F):5'- TCATTTCCAGGGCCTCAGAG -3'
(R):5'- cctgttgtctgtctgtctgtc -3'
Posted On2013-05-23