Incidental Mutation 'R0458:Olfr1500'
ID41342
Institutional Source Beutler Lab
Gene Symbol Olfr1500
Ensembl Gene ENSMUSG00000054526
Gene Nameolfactory receptor 1500
SynonymsMOR212-4P, GA_x6K02T2RE5P-4160554-4159619
MMRRC Submission 038658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0458 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13826882-13830488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13828229 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 56 (H56N)
Ref Sequence ENSEMBL: ENSMUSP00000151471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067670] [ENSMUST00000214475] [ENSMUST00000215760] [ENSMUST00000216287] [ENSMUST00000217079] [ENSMUST00000219674]
Predicted Effect probably benign
Transcript: ENSMUST00000067670
AA Change: H56N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000067303
Gene: ENSMUSG00000054526
AA Change: H56N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 220 9.5e-9 PFAM
Pfam:7tm_1 41 290 4.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214475
AA Change: H56N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214579
Predicted Effect probably benign
Transcript: ENSMUST00000215760
AA Change: H56N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216287
AA Change: H56N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000217079
AA Change: H56N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000219674
AA Change: H56N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik T C 16: 92,321,107 I98V probably benign Het
4933407L21Rik A G 1: 85,929,026 E8G unknown Het
9130008F23Rik T C 17: 40,880,236 T101A probably benign Het
Abcb8 C T 5: 24,406,233 T455I probably benign Het
Abcb9 C A 5: 124,082,146 probably null Het
Akp3 T G 1: 87,126,537 Y265* probably null Het
Atp6v1b1 A T 6: 83,752,408 D109V probably damaging Het
Aurka C A 2: 172,370,446 E4* probably null Het
Cacna1g T A 11: 94,409,440 Q2168L probably damaging Het
Cdc45 T A 16: 18,781,972 probably benign Het
Cfap61 T C 2: 146,008,917 V325A probably benign Het
Clasp2 T A 9: 113,906,224 probably null Het
Crim1 T A 17: 78,313,226 I365N probably damaging Het
Dcaf8 A G 1: 172,174,043 N269S probably benign Het
Dnaaf5 T C 5: 139,161,878 V399A possibly damaging Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Eef2k T C 7: 120,903,290 Y692H probably damaging Het
Elavl2 A T 4: 91,308,867 probably benign Het
Epn2 C A 11: 61,546,455 R97L possibly damaging Het
Fzd6 G A 15: 39,031,281 A281T probably damaging Het
Garem2 T A 5: 30,114,182 I214N probably damaging Het
Glg1 A G 8: 111,160,606 probably benign Het
Golm1 T C 13: 59,664,364 E48G probably damaging Het
Gpaa1 G T 15: 76,332,033 R12L probably benign Het
Gstm1 T A 3: 108,017,363 T34S probably benign Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc1 A T 9: 66,476,381 Q3709L probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icam1 A G 9: 21,027,861 probably null Het
Itga9 T C 9: 118,681,028 probably null Het
Kif15 T C 9: 123,009,359 F1121L probably benign Het
Klhl30 T A 1: 91,360,996 probably benign Het
Ldlrad1 T C 4: 107,216,190 C141R probably damaging Het
Lemd2 T C 17: 27,190,653 D508G probably damaging Het
Lilra5 A C 7: 4,238,219 T52P probably benign Het
Lrtm2 G A 6: 119,317,268 P301S probably damaging Het
Mcoln2 A G 3: 146,150,013 probably benign Het
Mkrn2os A G 6: 115,586,670 S135P probably damaging Het
Mlxipl T C 5: 135,133,370 V607A probably benign Het
Mmadhc T C 2: 50,281,161 Y213C probably benign Het
Mpo C A 11: 87,796,297 A223E probably benign Het
Mthfd2l C G 5: 91,020,177 I310M probably damaging Het
Muc5b C A 7: 141,864,972 A3885D probably benign Het
Mvp A G 7: 126,998,491 W152R probably damaging Het
Nmur2 A T 11: 56,040,568 F106I possibly damaging Het
Nr3c2 T A 8: 76,909,538 F423I probably damaging Het
Olfr1030 A G 2: 85,984,256 S139G probably benign Het
Olfr355 A G 2: 36,927,337 V259A probably damaging Het
Olfr894 G A 9: 38,219,048 C75Y probably damaging Het
Pappa A G 4: 65,155,882 I224M probably damaging Het
Prex1 A C 2: 166,585,823 S800A probably damaging Het
Prkaca T C 8: 83,995,282 probably benign Het
Ptpru A T 4: 131,799,675 V662E possibly damaging Het
Rabep1 T A 11: 70,886,998 probably null Het
Rbms2 C T 10: 128,151,189 C50Y probably damaging Het
Rd3 C T 1: 191,977,453 P25S probably damaging Het
Rnf148 T G 6: 23,654,257 I247L probably benign Het
Sf3b3 A G 8: 110,812,136 probably benign Het
Slc35c1 A T 2: 92,454,513 F252Y probably damaging Het
Slc38a11 T C 2: 65,363,469 probably null Het
Snx6 G T 12: 54,768,136 Y17* probably null Het
Sox6 C A 7: 115,489,794 R611L probably damaging Het
Spata13 G A 14: 60,692,043 R350H probably damaging Het
Sppl2a G T 2: 126,904,959 A483D probably damaging Het
Stat1 C T 1: 52,149,052 probably benign Het
Tab2 A T 10: 7,919,555 Y314N probably damaging Het
Tor1aip1 T C 1: 156,030,407 N213S probably damaging Het
Trim39 T C 17: 36,261,512 K300E probably damaging Het
Tubal3 T C 13: 3,933,137 S306P probably damaging Het
Ufm1 A G 3: 53,861,234 L33P probably damaging Het
Washc4 G A 10: 83,546,799 V26I possibly damaging Het
Wfs1 A G 5: 36,968,669 Y293H probably damaging Het
Zbtb41 T C 1: 139,423,476 V109A probably damaging Het
Zfp667 T C 7: 6,304,845 S171P probably benign Het
Zkscan5 T A 5: 145,205,471 H59Q probably damaging Het
Zswim8 C T 14: 20,718,897 R1128W probably damaging Het
Other mutations in Olfr1500
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02004:Olfr1500 APN 19 13828063 missense possibly damaging 0.93
IGL03122:Olfr1500 APN 19 13827650 missense possibly damaging 0.91
R0003:Olfr1500 UTSW 19 13827686 missense probably damaging 1.00
R0003:Olfr1500 UTSW 19 13827686 missense probably damaging 1.00
R0118:Olfr1500 UTSW 19 13827565 missense possibly damaging 0.74
R0507:Olfr1500 UTSW 19 13827776 missense possibly damaging 0.49
R0515:Olfr1500 UTSW 19 13827821 missense probably damaging 0.99
R0907:Olfr1500 UTSW 19 13827856 missense probably damaging 1.00
R1524:Olfr1500 UTSW 19 13828315 missense probably damaging 1.00
R2883:Olfr1500 UTSW 19 13827875 missense probably damaging 1.00
R4278:Olfr1500 UTSW 19 13828429 start gained probably benign
R4824:Olfr1500 UTSW 19 13828354 missense probably damaging 1.00
R4981:Olfr1500 UTSW 19 13828094 missense probably damaging 1.00
R5785:Olfr1500 UTSW 19 13827619 missense probably damaging 1.00
R6597:Olfr1500 UTSW 19 13828457 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAGATTGTCCTCACCAAGGCACTG -3'
(R):5'- GGGGCATCTGAAGTTCATCATCCTG -3'

Sequencing Primer
(F):5'- CAAAACTTAGAAGGGCTTTCTGTGTC -3'
(R):5'- AAGTACCACTGGCTTCATGGC -3'
Posted On2013-05-23