Incidental Mutation 'R0462:Flg2'
ID41349
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission 038662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0462 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93201437 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 257 (E257D)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
Predicted Effect probably benign
Transcript: ENSMUST00000098884
AA Change: E257D

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: E257D

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,661,749 probably benign Het
1700022I11Rik T A 4: 42,973,429 F921I probably benign Het
9530053A07Rik A T 7: 28,137,340 D228V probably damaging Het
Aarsd1 A T 11: 101,414,091 D190E probably damaging Het
Acnat2 A G 4: 49,383,084 probably null Het
Acot10 T G 15: 20,666,626 T10P possibly damaging Het
Aldh7a1 T C 18: 56,534,214 probably null Het
Alkbh7 G A 17: 56,998,443 V87I probably benign Het
Ano2 A T 6: 125,712,275 H121L probably benign Het
Apob A T 12: 8,000,896 Y1040F probably damaging Het
Arhgap25 A T 6: 87,459,960 V636E possibly damaging Het
Atad2b A T 12: 4,941,973 T191S possibly damaging Het
Btbd9 A T 17: 30,530,217 V41D possibly damaging Het
Bzw2 G A 12: 36,124,024 R25C probably damaging Het
Carmil1 T C 13: 24,022,511 S1326G probably benign Het
Cdh18 A G 15: 23,366,885 R226G probably damaging Het
Cdh3 A G 8: 106,555,380 N800S possibly damaging Het
Cep152 A T 2: 125,583,934 V837E possibly damaging Het
Cep85 G A 4: 134,131,421 T713M possibly damaging Het
Chd7 T C 4: 8,850,821 Y1736H probably damaging Het
Chst3 T C 10: 60,186,713 E104G probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cmah T A 13: 24,436,741 S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 F233L probably benign Het
Cpne5 T C 17: 29,176,189 E251G probably benign Het
Csf2rb2 G A 15: 78,285,173 P485L probably damaging Het
Dimt1 T C 13: 106,948,756 M70T possibly damaging Het
Dlk2 A G 17: 46,303,098 *383W probably null Het
Dnah2 G A 11: 69,459,201 R2369C probably damaging Het
Dock2 A G 11: 34,268,052 F1173L possibly damaging Het
Dok7 A G 5: 35,066,462 H115R possibly damaging Het
Dpy19l1 A G 9: 24,414,349 I720T probably benign Het
Eps8 A T 6: 137,514,311 D356E probably benign Het
Exoc1 A G 5: 76,543,617 N263D probably benign Het
Fam173b T C 15: 31,616,872 M161T probably damaging Het
Fbxl3 T C 14: 103,082,886 D375G probably damaging Het
Fstl4 A G 11: 53,186,402 D662G probably benign Het
Gbp10 G T 5: 105,218,524 Q505K possibly damaging Het
Gemin2 C T 12: 59,013,519 P15S probably damaging Het
Gm14124 A G 2: 150,269,202 E604G possibly damaging Het
Grhl2 A G 15: 37,344,675 M514V probably benign Het
Hgs A G 11: 120,479,144 N413D possibly damaging Het
Il12rb2 T C 6: 67,303,610 S538G possibly damaging Het
Kdm5a A G 6: 120,402,600 D623G probably damaging Het
Kif1bp A T 10: 62,559,456 I469N probably damaging Het
Matk G T 10: 81,259,693 V116F probably damaging Het
Mcm3 T C 1: 20,805,332 T694A probably benign Het
Mctp1 C A 13: 76,801,401 H260Q probably damaging Het
Mios T A 6: 8,215,743 I313K probably benign Het
Muc4 T A 16: 32,762,536 Y2562N possibly damaging Het
Naip5 T A 13: 100,221,732 I999F probably damaging Het
Olfr128 A T 17: 37,923,776 D70V probably damaging Het
Olfr1375 A G 11: 51,048,509 Y134C probably damaging Het
Olfr68 A T 7: 103,777,563 S261T probably benign Het
Olfr749 T A 14: 50,737,097 I22L probably benign Het
Olfr834 A T 9: 18,988,902 I305F probably benign Het
Olfr965 T A 9: 39,719,410 F61Y probably benign Het
Pafah1b1 A G 11: 74,677,715 V396A probably benign Het
Pard6b T A 2: 168,087,547 I91N possibly damaging Het
Pdzd2 T C 15: 12,592,160 S133G probably damaging Het
Plcg2 T G 8: 117,585,305 S445R probably benign Het
Plekhd1 G T 12: 80,721,578 V396L probably damaging Het
Ppp4r2 A G 6: 100,866,557 D294G possibly damaging Het
Ppwd1 T C 13: 104,222,960 probably null Het
Prr22 A G 17: 56,770,551 probably benign Het
Psme4 A G 11: 30,848,117 D1370G probably damaging Het
Rac3 T A 11: 120,722,858 V86D probably damaging Het
Rnf207 T C 4: 152,313,372 S335G possibly damaging Het
Rxfp3 A G 15: 11,036,977 L103P probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Smpdl3a G T 10: 57,794,731 C17F probably benign Het
Spen A T 4: 141,473,651 I2555N probably damaging Het
Srpk2 G T 5: 23,518,426 T564K probably damaging Het
Stard4 C T 18: 33,205,149 R116H probably damaging Het
Supt7l A T 5: 31,520,296 S175R probably damaging Het
Sycp1 A T 3: 102,819,106 Y932N possibly damaging Het
Tas2r122 T C 6: 132,711,178 M251V probably benign Het
Tbx15 A T 3: 99,316,318 E274V probably damaging Het
Tex52 A G 6: 128,384,954 E298G probably benign Het
Tmem101 T C 11: 102,155,867 M59V probably benign Het
Tmem132b T C 5: 125,785,926 V665A probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Ush2a A G 1: 188,910,939 H4166R probably benign Het
Vmn2r101 G T 17: 19,590,169 V406L probably benign Het
Vrk3 A G 7: 44,764,200 D166G possibly damaging Het
Washc4 T A 10: 83,556,913 M259K probably benign Het
Wdr70 T C 15: 8,079,161 D167G probably benign Het
Zfp28 A T 7: 6,392,240 Q248L possibly damaging Het
Zfp39 A G 11: 58,890,406 I510T probably benign Het
Zfp710 T A 7: 80,090,341 *646R probably null Het
Zfp90 C T 8: 106,425,260 S535L possibly damaging Het
Zfp949 C T 9: 88,568,734 T119I possibly damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACGGGGACCTGCAAAACATAG -3'
(R):5'- AGAGGACTGACCTTCTGAGACACAC -3'

Sequencing Primer
(F):5'- GGCAAGATGAATTATCCAGCTC -3'
(R):5'- CACTAGTTCCTGATTGACAGTTTGAC -3'
Posted On2013-05-23