Incidental Mutation 'R0462:Il12rb2'
ID41370
Institutional Source Beutler Lab
Gene Symbol Il12rb2
Ensembl Gene ENSMUSG00000018341
Gene Nameinterleukin 12 receptor, beta 2
SynonymsIL-12RB2, Ifnm, A930027I18Rik
MMRRC Submission 038662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0462 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location67291318-67376188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67303610 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 538 (S538G)
Ref Sequence ENSEMBL: ENSMUSP00000010605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018485] [ENSMUST00000117441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018485
AA Change: S538G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: S538G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lep_receptor_Ig 28 120 6.4e-20 PFAM
FN3 137 225 2.41e0 SMART
FN3 240 320 3.4e-4 SMART
Blast:FN3 340 434 2e-40 BLAST
FN3 436 525 3.17e-4 SMART
FN3 534 622 6.45e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117441
AA Change: S204G

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113267
Gene: ENSMUSG00000018341
AA Change: S204G

DomainStartEndE-ValueType
Blast:FN3 6 100 1e-41 BLAST
FN3 102 191 3.17e-4 SMART
FN3 200 288 6.45e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,661,749 probably benign Het
1700022I11Rik T A 4: 42,973,429 F921I probably benign Het
9530053A07Rik A T 7: 28,137,340 D228V probably damaging Het
Aarsd1 A T 11: 101,414,091 D190E probably damaging Het
Acnat2 A G 4: 49,383,084 probably null Het
Acot10 T G 15: 20,666,626 T10P possibly damaging Het
Aldh7a1 T C 18: 56,534,214 probably null Het
Alkbh7 G A 17: 56,998,443 V87I probably benign Het
Ano2 A T 6: 125,712,275 H121L probably benign Het
Apob A T 12: 8,000,896 Y1040F probably damaging Het
Arhgap25 A T 6: 87,459,960 V636E possibly damaging Het
Atad2b A T 12: 4,941,973 T191S possibly damaging Het
Btbd9 A T 17: 30,530,217 V41D possibly damaging Het
Bzw2 G A 12: 36,124,024 R25C probably damaging Het
Carmil1 T C 13: 24,022,511 S1326G probably benign Het
Cdh18 A G 15: 23,366,885 R226G probably damaging Het
Cdh3 A G 8: 106,555,380 N800S possibly damaging Het
Cep152 A T 2: 125,583,934 V837E possibly damaging Het
Cep85 G A 4: 134,131,421 T713M possibly damaging Het
Chd7 T C 4: 8,850,821 Y1736H probably damaging Het
Chst3 T C 10: 60,186,713 E104G probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cmah T A 13: 24,436,741 S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 F233L probably benign Het
Cpne5 T C 17: 29,176,189 E251G probably benign Het
Csf2rb2 G A 15: 78,285,173 P485L probably damaging Het
Dimt1 T C 13: 106,948,756 M70T possibly damaging Het
Dlk2 A G 17: 46,303,098 *383W probably null Het
Dnah2 G A 11: 69,459,201 R2369C probably damaging Het
Dock2 A G 11: 34,268,052 F1173L possibly damaging Het
Dok7 A G 5: 35,066,462 H115R possibly damaging Het
Dpy19l1 A G 9: 24,414,349 I720T probably benign Het
Eps8 A T 6: 137,514,311 D356E probably benign Het
Exoc1 A G 5: 76,543,617 N263D probably benign Het
Fam173b T C 15: 31,616,872 M161T probably damaging Het
Fbxl3 T C 14: 103,082,886 D375G probably damaging Het
Flg2 A T 3: 93,201,437 E257D probably benign Het
Fstl4 A G 11: 53,186,402 D662G probably benign Het
Gbp10 G T 5: 105,218,524 Q505K possibly damaging Het
Gemin2 C T 12: 59,013,519 P15S probably damaging Het
Gm14124 A G 2: 150,269,202 E604G possibly damaging Het
Grhl2 A G 15: 37,344,675 M514V probably benign Het
Hgs A G 11: 120,479,144 N413D possibly damaging Het
Kdm5a A G 6: 120,402,600 D623G probably damaging Het
Kif1bp A T 10: 62,559,456 I469N probably damaging Het
Matk G T 10: 81,259,693 V116F probably damaging Het
Mcm3 T C 1: 20,805,332 T694A probably benign Het
Mctp1 C A 13: 76,801,401 H260Q probably damaging Het
Mios T A 6: 8,215,743 I313K probably benign Het
Muc4 T A 16: 32,762,536 Y2562N possibly damaging Het
Naip5 T A 13: 100,221,732 I999F probably damaging Het
Olfr128 A T 17: 37,923,776 D70V probably damaging Het
Olfr1375 A G 11: 51,048,509 Y134C probably damaging Het
Olfr68 A T 7: 103,777,563 S261T probably benign Het
Olfr749 T A 14: 50,737,097 I22L probably benign Het
Olfr834 A T 9: 18,988,902 I305F probably benign Het
Olfr965 T A 9: 39,719,410 F61Y probably benign Het
Pafah1b1 A G 11: 74,677,715 V396A probably benign Het
Pard6b T A 2: 168,087,547 I91N possibly damaging Het
Pdzd2 T C 15: 12,592,160 S133G probably damaging Het
Plcg2 T G 8: 117,585,305 S445R probably benign Het
Plekhd1 G T 12: 80,721,578 V396L probably damaging Het
Ppp4r2 A G 6: 100,866,557 D294G possibly damaging Het
Ppwd1 T C 13: 104,222,960 probably null Het
Prr22 A G 17: 56,770,551 probably benign Het
Psme4 A G 11: 30,848,117 D1370G probably damaging Het
Rac3 T A 11: 120,722,858 V86D probably damaging Het
Rnf207 T C 4: 152,313,372 S335G possibly damaging Het
Rxfp3 A G 15: 11,036,977 L103P probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Smpdl3a G T 10: 57,794,731 C17F probably benign Het
Spen A T 4: 141,473,651 I2555N probably damaging Het
Srpk2 G T 5: 23,518,426 T564K probably damaging Het
Stard4 C T 18: 33,205,149 R116H probably damaging Het
Supt7l A T 5: 31,520,296 S175R probably damaging Het
Sycp1 A T 3: 102,819,106 Y932N possibly damaging Het
Tas2r122 T C 6: 132,711,178 M251V probably benign Het
Tbx15 A T 3: 99,316,318 E274V probably damaging Het
Tex52 A G 6: 128,384,954 E298G probably benign Het
Tmem101 T C 11: 102,155,867 M59V probably benign Het
Tmem132b T C 5: 125,785,926 V665A probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Ush2a A G 1: 188,910,939 H4166R probably benign Het
Vmn2r101 G T 17: 19,590,169 V406L probably benign Het
Vrk3 A G 7: 44,764,200 D166G possibly damaging Het
Washc4 T A 10: 83,556,913 M259K probably benign Het
Wdr70 T C 15: 8,079,161 D167G probably benign Het
Zfp28 A T 7: 6,392,240 Q248L possibly damaging Het
Zfp39 A G 11: 58,890,406 I510T probably benign Het
Zfp710 T A 7: 80,090,341 *646R probably null Het
Zfp90 C T 8: 106,425,260 S535L possibly damaging Het
Zfp949 C T 9: 88,568,734 T119I possibly damaging Het
Other mutations in Il12rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Il12rb2 APN 6 67357692 missense probably damaging 0.98
IGL00767:Il12rb2 APN 6 67303562 missense possibly damaging 0.63
IGL00835:Il12rb2 APN 6 67360567 missense probably damaging 0.99
IGL00864:Il12rb2 APN 6 67336754 missense probably benign
IGL00965:Il12rb2 APN 6 67360577 missense probably damaging 0.98
IGL01161:Il12rb2 APN 6 67361865 splice site probably benign
IGL01980:Il12rb2 APN 6 67360535 missense probably benign
IGL02246:Il12rb2 APN 6 67308956 critical splice donor site probably null
IGL02807:Il12rb2 APN 6 67351316 missense probably damaging 1.00
R0003:Il12rb2 UTSW 6 67316286 missense probably damaging 1.00
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0079:Il12rb2 UTSW 6 67361905 missense probably benign 0.00
R0709:Il12rb2 UTSW 6 67298904 splice site probably benign
R0828:Il12rb2 UTSW 6 67356707 missense probably benign
R1051:Il12rb2 UTSW 6 67356735 missense probably benign
R1191:Il12rb2 UTSW 6 67298216 missense possibly damaging 0.90
R1446:Il12rb2 UTSW 6 67309143 missense probably benign
R1559:Il12rb2 UTSW 6 67356592 missense probably benign 0.12
R1677:Il12rb2 UTSW 6 67303501 missense probably damaging 1.00
R1689:Il12rb2 UTSW 6 67336760 missense probably benign 0.01
R1907:Il12rb2 UTSW 6 67295286 nonsense probably null
R1952:Il12rb2 UTSW 6 67292316 missense probably damaging 0.99
R2048:Il12rb2 UTSW 6 67360545 missense probably benign 0.05
R2074:Il12rb2 UTSW 6 67360552 missense probably damaging 1.00
R2351:Il12rb2 UTSW 6 67361944 nonsense probably null
R2358:Il12rb2 UTSW 6 67298195 missense probably damaging 0.96
R2680:Il12rb2 UTSW 6 67354805 missense possibly damaging 0.94
R2920:Il12rb2 UTSW 6 67360568 missense probably damaging 0.96
R3107:Il12rb2 UTSW 6 67360798 missense probably damaging 1.00
R4420:Il12rb2 UTSW 6 67316410 splice site probably null
R4838:Il12rb2 UTSW 6 67309137 missense probably damaging 1.00
R5391:Il12rb2 UTSW 6 67292420 missense probably benign 0.24
R5532:Il12rb2 UTSW 6 67292262 missense probably damaging 1.00
R5696:Il12rb2 UTSW 6 67295278 missense possibly damaging 0.94
R5704:Il12rb2 UTSW 6 67292213 missense possibly damaging 0.53
R5891:Il12rb2 UTSW 6 67360690 missense probably damaging 0.97
R6482:Il12rb2 UTSW 6 67356686 missense probably damaging 1.00
R6749:Il12rb2 UTSW 6 67361966 start gained probably benign
R6813:Il12rb2 UTSW 6 67292374 missense probably damaging 0.98
R6957:Il12rb2 UTSW 6 67292652 missense possibly damaging 0.60
R7312:Il12rb2 UTSW 6 67356633 missense probably benign 0.29
R7361:Il12rb2 UTSW 6 67303466 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCTAAGCAGGAGGCCCTAATGCAC -3'
(R):5'- GCATAAGCCATTGCTCTACCCTCAG -3'

Sequencing Primer
(F):5'- AGGCCCTAATGCACTAGGATTTC -3'
(R):5'- TCTCTCTCTTGCAGAGAACATAAAGC -3'
Posted On2013-05-23