Incidental Mutation 'R0462:Matk'
ID41396
Institutional Source Beutler Lab
Gene Symbol Matk
Ensembl Gene ENSMUSG00000004933
Gene Namemegakaryocyte-associated tyrosine kinase
SynonymsCHK, Csk homologous kinase, Ntk, HYL
MMRRC Submission 038662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0462 (G1)
Quality Score219
Status Not validated
Chromosome10
Chromosomal Location81252935-81263365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81259693 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 116 (V116F)
Ref Sequence ENSEMBL: ENSMUSP00000122445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105328] [ENSMUST00000117488] [ENSMUST00000119547] [ENSMUST00000120265] [ENSMUST00000121205] [ENSMUST00000128576] [ENSMUST00000130282]
Predicted Effect probably damaging
Transcript: ENSMUST00000105328
AA Change: V115F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100965
Gene: ENSMUSG00000004933
AA Change: V115F

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117488
AA Change: V155F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113221
Gene: ENSMUSG00000004933
AA Change: V155F

DomainStartEndE-ValueType
SH3 49 107 1.37e-5 SMART
SH2 118 200 4.87e-31 SMART
TyrKc 233 476 2.88e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119547
AA Change: V115F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113576
Gene: ENSMUSG00000004933
AA Change: V115F

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120265
AA Change: V116F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113666
Gene: ENSMUSG00000004933
AA Change: V116F

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121205
AA Change: V116F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113043
Gene: ENSMUSG00000004933
AA Change: V116F

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126720
Predicted Effect probably damaging
Transcript: ENSMUST00000128576
AA Change: V116F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122445
Gene: ENSMUSG00000004933
AA Change: V116F

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 1.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130282
SMART Domains Protein: ENSMUSP00000114233
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
PDB:1JWO|A 75 101 1e-12 PDB
Blast:SH2 78 101 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151660
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has amino acid sequence similarity to Csk tyrosine kinase and has the structural features of the CSK subfamily: SRC homology SH2 and SH3 domains, a catalytic domain, a unique N terminus, lack of myristylation signals, lack of a negative regulatory phosphorylation site, and lack of an autophosphorylation site. This protein is thought to play a significant role in the signal transduction of hematopoietic cells. It is able to phosphorylate and inactivate Src family kinases, and may play an inhibitory role in the control of T-cell proliferation. This protein might be involved in signaling in some cases of breast cancer. Three alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice are viable and fertile and appear normal. Unchallenged mutant mice exhibit no hematopoietic defects. SPKLS cell numbers are elevated. IL-7 induced BM cell proliferation and pre-B cell colony formation are enhanced. Antigen induced IFN-gamma secretion is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,661,749 probably benign Het
1700022I11Rik T A 4: 42,973,429 F921I probably benign Het
9530053A07Rik A T 7: 28,137,340 D228V probably damaging Het
Aarsd1 A T 11: 101,414,091 D190E probably damaging Het
Acnat2 A G 4: 49,383,084 probably null Het
Acot10 T G 15: 20,666,626 T10P possibly damaging Het
Aldh7a1 T C 18: 56,534,214 probably null Het
Alkbh7 G A 17: 56,998,443 V87I probably benign Het
Ano2 A T 6: 125,712,275 H121L probably benign Het
Apob A T 12: 8,000,896 Y1040F probably damaging Het
Arhgap25 A T 6: 87,459,960 V636E possibly damaging Het
Atad2b A T 12: 4,941,973 T191S possibly damaging Het
Btbd9 A T 17: 30,530,217 V41D possibly damaging Het
Bzw2 G A 12: 36,124,024 R25C probably damaging Het
Carmil1 T C 13: 24,022,511 S1326G probably benign Het
Cdh18 A G 15: 23,366,885 R226G probably damaging Het
Cdh3 A G 8: 106,555,380 N800S possibly damaging Het
Cep152 A T 2: 125,583,934 V837E possibly damaging Het
Cep85 G A 4: 134,131,421 T713M possibly damaging Het
Chd7 T C 4: 8,850,821 Y1736H probably damaging Het
Chst3 T C 10: 60,186,713 E104G probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cmah T A 13: 24,436,741 S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 F233L probably benign Het
Cpne5 T C 17: 29,176,189 E251G probably benign Het
Csf2rb2 G A 15: 78,285,173 P485L probably damaging Het
Dimt1 T C 13: 106,948,756 M70T possibly damaging Het
Dlk2 A G 17: 46,303,098 *383W probably null Het
Dnah2 G A 11: 69,459,201 R2369C probably damaging Het
Dock2 A G 11: 34,268,052 F1173L possibly damaging Het
Dok7 A G 5: 35,066,462 H115R possibly damaging Het
Dpy19l1 A G 9: 24,414,349 I720T probably benign Het
Eps8 A T 6: 137,514,311 D356E probably benign Het
Exoc1 A G 5: 76,543,617 N263D probably benign Het
Fam173b T C 15: 31,616,872 M161T probably damaging Het
Fbxl3 T C 14: 103,082,886 D375G probably damaging Het
Flg2 A T 3: 93,201,437 E257D probably benign Het
Fstl4 A G 11: 53,186,402 D662G probably benign Het
Gbp10 G T 5: 105,218,524 Q505K possibly damaging Het
Gemin2 C T 12: 59,013,519 P15S probably damaging Het
Gm14124 A G 2: 150,269,202 E604G possibly damaging Het
Grhl2 A G 15: 37,344,675 M514V probably benign Het
Hgs A G 11: 120,479,144 N413D possibly damaging Het
Il12rb2 T C 6: 67,303,610 S538G possibly damaging Het
Kdm5a A G 6: 120,402,600 D623G probably damaging Het
Kif1bp A T 10: 62,559,456 I469N probably damaging Het
Mcm3 T C 1: 20,805,332 T694A probably benign Het
Mctp1 C A 13: 76,801,401 H260Q probably damaging Het
Mios T A 6: 8,215,743 I313K probably benign Het
Muc4 T A 16: 32,762,536 Y2562N possibly damaging Het
Naip5 T A 13: 100,221,732 I999F probably damaging Het
Olfr128 A T 17: 37,923,776 D70V probably damaging Het
Olfr1375 A G 11: 51,048,509 Y134C probably damaging Het
Olfr68 A T 7: 103,777,563 S261T probably benign Het
Olfr749 T A 14: 50,737,097 I22L probably benign Het
Olfr834 A T 9: 18,988,902 I305F probably benign Het
Olfr965 T A 9: 39,719,410 F61Y probably benign Het
Pafah1b1 A G 11: 74,677,715 V396A probably benign Het
Pard6b T A 2: 168,087,547 I91N possibly damaging Het
Pdzd2 T C 15: 12,592,160 S133G probably damaging Het
Plcg2 T G 8: 117,585,305 S445R probably benign Het
Plekhd1 G T 12: 80,721,578 V396L probably damaging Het
Ppp4r2 A G 6: 100,866,557 D294G possibly damaging Het
Ppwd1 T C 13: 104,222,960 probably null Het
Prr22 A G 17: 56,770,551 probably benign Het
Psme4 A G 11: 30,848,117 D1370G probably damaging Het
Rac3 T A 11: 120,722,858 V86D probably damaging Het
Rnf207 T C 4: 152,313,372 S335G possibly damaging Het
Rxfp3 A G 15: 11,036,977 L103P probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Smpdl3a G T 10: 57,794,731 C17F probably benign Het
Spen A T 4: 141,473,651 I2555N probably damaging Het
Srpk2 G T 5: 23,518,426 T564K probably damaging Het
Stard4 C T 18: 33,205,149 R116H probably damaging Het
Supt7l A T 5: 31,520,296 S175R probably damaging Het
Sycp1 A T 3: 102,819,106 Y932N possibly damaging Het
Tas2r122 T C 6: 132,711,178 M251V probably benign Het
Tbx15 A T 3: 99,316,318 E274V probably damaging Het
Tex52 A G 6: 128,384,954 E298G probably benign Het
Tmem101 T C 11: 102,155,867 M59V probably benign Het
Tmem132b T C 5: 125,785,926 V665A probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Ush2a A G 1: 188,910,939 H4166R probably benign Het
Vmn2r101 G T 17: 19,590,169 V406L probably benign Het
Vrk3 A G 7: 44,764,200 D166G possibly damaging Het
Washc4 T A 10: 83,556,913 M259K probably benign Het
Wdr70 T C 15: 8,079,161 D167G probably benign Het
Zfp28 A T 7: 6,392,240 Q248L possibly damaging Het
Zfp39 A G 11: 58,890,406 I510T probably benign Het
Zfp710 T A 7: 80,090,341 *646R probably null Het
Zfp90 C T 8: 106,425,260 S535L possibly damaging Het
Zfp949 C T 9: 88,568,734 T119I possibly damaging Het
Other mutations in Matk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Matk APN 10 81258294 missense probably benign
R0153:Matk UTSW 10 81262842 missense probably benign 0.01
R0243:Matk UTSW 10 81258492 missense probably benign 0.03
R0349:Matk UTSW 10 81258494 missense probably benign
R0562:Matk UTSW 10 81259691 missense probably benign 0.26
R0732:Matk UTSW 10 81258306 critical splice donor site probably null
R2356:Matk UTSW 10 81261543 critical splice donor site probably null
R3773:Matk UTSW 10 81258297 missense probably benign 0.05
R4420:Matk UTSW 10 81262457 missense possibly damaging 0.63
R4855:Matk UTSW 10 81262886 unclassified probably benign
R5873:Matk UTSW 10 81260129 missense probably benign 0.10
R5906:Matk UTSW 10 81260919 missense probably damaging 1.00
R6209:Matk UTSW 10 81259588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACTCAATGCATGACCAAGTG -3'
(R):5'- GGGGCCACCATCCATATTTCCATC -3'

Sequencing Primer
(F):5'- AAGTGTGAGAACTCTCGCC -3'
(R):5'- ACCATCCATATTTCCATCCCTCC -3'
Posted On2013-05-23