Incidental Mutation 'R0462:Naip5'
ID41419
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene NameNLR family, apoptosis inhibitory protein 5
SynonymsBirc1e, Lgn1, Naip-rs3
MMRRC Submission 038662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0462 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100211739-100246323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100221732 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 999 (I999F)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
Predicted Effect probably damaging
Transcript: ENSMUST00000049789
AA Change: I999F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: I999F

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,661,749 probably benign Het
1700022I11Rik T A 4: 42,973,429 F921I probably benign Het
9530053A07Rik A T 7: 28,137,340 D228V probably damaging Het
Aarsd1 A T 11: 101,414,091 D190E probably damaging Het
Acnat2 A G 4: 49,383,084 probably null Het
Acot10 T G 15: 20,666,626 T10P possibly damaging Het
Aldh7a1 T C 18: 56,534,214 probably null Het
Alkbh7 G A 17: 56,998,443 V87I probably benign Het
Ano2 A T 6: 125,712,275 H121L probably benign Het
Apob A T 12: 8,000,896 Y1040F probably damaging Het
Arhgap25 A T 6: 87,459,960 V636E possibly damaging Het
Atad2b A T 12: 4,941,973 T191S possibly damaging Het
Btbd9 A T 17: 30,530,217 V41D possibly damaging Het
Bzw2 G A 12: 36,124,024 R25C probably damaging Het
Carmil1 T C 13: 24,022,511 S1326G probably benign Het
Cdh18 A G 15: 23,366,885 R226G probably damaging Het
Cdh3 A G 8: 106,555,380 N800S possibly damaging Het
Cep152 A T 2: 125,583,934 V837E possibly damaging Het
Cep85 G A 4: 134,131,421 T713M possibly damaging Het
Chd7 T C 4: 8,850,821 Y1736H probably damaging Het
Chst3 T C 10: 60,186,713 E104G probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cmah T A 13: 24,436,741 S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 F233L probably benign Het
Cpne5 T C 17: 29,176,189 E251G probably benign Het
Csf2rb2 G A 15: 78,285,173 P485L probably damaging Het
Dimt1 T C 13: 106,948,756 M70T possibly damaging Het
Dlk2 A G 17: 46,303,098 *383W probably null Het
Dnah2 G A 11: 69,459,201 R2369C probably damaging Het
Dock2 A G 11: 34,268,052 F1173L possibly damaging Het
Dok7 A G 5: 35,066,462 H115R possibly damaging Het
Dpy19l1 A G 9: 24,414,349 I720T probably benign Het
Eps8 A T 6: 137,514,311 D356E probably benign Het
Exoc1 A G 5: 76,543,617 N263D probably benign Het
Fam173b T C 15: 31,616,872 M161T probably damaging Het
Fbxl3 T C 14: 103,082,886 D375G probably damaging Het
Flg2 A T 3: 93,201,437 E257D probably benign Het
Fstl4 A G 11: 53,186,402 D662G probably benign Het
Gbp10 G T 5: 105,218,524 Q505K possibly damaging Het
Gemin2 C T 12: 59,013,519 P15S probably damaging Het
Gm14124 A G 2: 150,269,202 E604G possibly damaging Het
Grhl2 A G 15: 37,344,675 M514V probably benign Het
Hgs A G 11: 120,479,144 N413D possibly damaging Het
Il12rb2 T C 6: 67,303,610 S538G possibly damaging Het
Kdm5a A G 6: 120,402,600 D623G probably damaging Het
Kif1bp A T 10: 62,559,456 I469N probably damaging Het
Matk G T 10: 81,259,693 V116F probably damaging Het
Mcm3 T C 1: 20,805,332 T694A probably benign Het
Mctp1 C A 13: 76,801,401 H260Q probably damaging Het
Mios T A 6: 8,215,743 I313K probably benign Het
Muc4 T A 16: 32,762,536 Y2562N possibly damaging Het
Olfr128 A T 17: 37,923,776 D70V probably damaging Het
Olfr1375 A G 11: 51,048,509 Y134C probably damaging Het
Olfr68 A T 7: 103,777,563 S261T probably benign Het
Olfr749 T A 14: 50,737,097 I22L probably benign Het
Olfr834 A T 9: 18,988,902 I305F probably benign Het
Olfr965 T A 9: 39,719,410 F61Y probably benign Het
Pafah1b1 A G 11: 74,677,715 V396A probably benign Het
Pard6b T A 2: 168,087,547 I91N possibly damaging Het
Pdzd2 T C 15: 12,592,160 S133G probably damaging Het
Plcg2 T G 8: 117,585,305 S445R probably benign Het
Plekhd1 G T 12: 80,721,578 V396L probably damaging Het
Ppp4r2 A G 6: 100,866,557 D294G possibly damaging Het
Ppwd1 T C 13: 104,222,960 probably null Het
Prr22 A G 17: 56,770,551 probably benign Het
Psme4 A G 11: 30,848,117 D1370G probably damaging Het
Rac3 T A 11: 120,722,858 V86D probably damaging Het
Rnf207 T C 4: 152,313,372 S335G possibly damaging Het
Rxfp3 A G 15: 11,036,977 L103P probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Smpdl3a G T 10: 57,794,731 C17F probably benign Het
Spen A T 4: 141,473,651 I2555N probably damaging Het
Srpk2 G T 5: 23,518,426 T564K probably damaging Het
Stard4 C T 18: 33,205,149 R116H probably damaging Het
Supt7l A T 5: 31,520,296 S175R probably damaging Het
Sycp1 A T 3: 102,819,106 Y932N possibly damaging Het
Tas2r122 T C 6: 132,711,178 M251V probably benign Het
Tbx15 A T 3: 99,316,318 E274V probably damaging Het
Tex52 A G 6: 128,384,954 E298G probably benign Het
Tmem101 T C 11: 102,155,867 M59V probably benign Het
Tmem132b T C 5: 125,785,926 V665A probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Ush2a A G 1: 188,910,939 H4166R probably benign Het
Vmn2r101 G T 17: 19,590,169 V406L probably benign Het
Vrk3 A G 7: 44,764,200 D166G possibly damaging Het
Washc4 T A 10: 83,556,913 M259K probably benign Het
Wdr70 T C 15: 8,079,161 D167G probably benign Het
Zfp28 A T 7: 6,392,240 Q248L possibly damaging Het
Zfp39 A G 11: 58,890,406 I510T probably benign Het
Zfp710 T A 7: 80,090,341 *646R probably null Het
Zfp90 C T 8: 106,425,260 S535L possibly damaging Het
Zfp949 C T 9: 88,568,734 T119I possibly damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
Predicted Primers PCR Primer
(F):5'- CCTGGACATGGAACACTTGGTGAC -3'
(R):5'- GTACTTTAGGGACCACCCAGAAAGC -3'

Sequencing Primer
(F):5'- ACACTTGGTGACAGAGGC -3'
(R):5'- CCAGAAAGCCTGTTACTGTTGAG -3'
Posted On2013-05-23