Incidental Mutation 'R0463:Ada'
ID41457
Institutional Source Beutler Lab
Gene Symbol Ada
Ensembl Gene ENSMUSG00000017697
Gene Nameadenosine deaminase
Synonyms
MMRRC Submission 038663-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0463 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location163726584-163750239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 163730351 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 243 (I243F)
Ref Sequence ENSEMBL: ENSMUSP00000017841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017841] [ENSMUST00000064703] [ENSMUST00000099105] [ENSMUST00000109400] [ENSMUST00000126182] [ENSMUST00000131228] [ENSMUST00000135537] [ENSMUST00000164399]
PDB Structure
ADA STRUCTURE COMPLEXED WITH DEOXYCOFORMYCIN AT PH 7.0 [X-RAY DIFFRACTION]
ADA STRUCTURE COMPLEXED WITH PURINE RIBOSIDE AT PH 7.0 [X-RAY DIFFRACTION]
A PRE-TRANSITION STATE MIMIC OF AN ENZYME: X-RAY STRUCTURE OF ADENOSINE DEAMINASE WITH BOUND 1-DEAZA-ADENOSINE AND ZINC-ACTIVATED WATER [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D295E) [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D296A) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 ALA MUTANT) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 GLU MUTANT) [X-RAY DIFFRACTION]
ATOMIC STRUCTURE OF ADENOSINE DEAMINASE COMPLEXED WITH A TRANSITION-STATE ANALOG: UNDERSTANDING CATALYSIS AND IMMUNODEFICIENCY MUTATIONS [X-RAY DIFFRACTION]
Crystal structuore of adenosine deaminase from mus musculus complexed with 9-deazainosine [X-RAY DIFFRACTION]
Crystal structure of holo mADA at 1.6 A resolution [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000017841
AA Change: I243F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000017841
Gene: ENSMUSG00000017697
AA Change: I243F

DomainStartEndE-ValueType
Pfam:A_deaminase 8 346 1.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064703
SMART Domains Protein: ENSMUSP00000068344
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 70 5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099105
SMART Domains Protein: ENSMUSP00000096704
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 75 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109400
SMART Domains Protein: ENSMUSP00000105027
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 75 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126182
SMART Domains Protein: ENSMUSP00000120145
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 75 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131228
SMART Domains Protein: ENSMUSP00000120355
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 70 4.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135537
SMART Domains Protein: ENSMUSP00000114291
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 56 7.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156939
Predicted Effect probably benign
Transcript: ENSMUST00000164399
SMART Domains Protein: ENSMUSP00000126223
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 75 1.3e-33 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have been described for this gene and have been linked to human diseases. Deficiency in this enzyme causes a form of severe combined immunodeficiency disease (SCID), in which there is dysfunction of both B and T lymphocytes with impaired cellular immunity and decreased production of immunoglobulins, whereas elevated levels of this enzyme have been associated with congenital hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene die perinatally with defective purine metabolism and severe liver cell degeneration, but lack thymic abnormalities. Replacement of placental ADA can rescue ADA-deficient fetuses, resulting in mice that are T and B-cell deficient, have elevated dATP levels, and immune deficiencies resembling human ADA deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,737,060 probably benign Het
Abcd2 C T 15: 91,159,124 M620I probably benign Het
Adam12 T C 7: 133,974,416 probably null Het
Adarb2 A T 13: 8,203,188 probably benign Het
Adk A C 14: 21,423,536 Q287P probably benign Het
Ahnak A G 19: 9,009,407 probably benign Het
Aoc3 C T 11: 101,331,606 R223W probably damaging Het
Aqp11 T C 7: 97,729,021 D229G probably benign Het
Arhgap28 A G 17: 67,896,225 S78P probably damaging Het
Bfsp2 T A 9: 103,426,655 E383D possibly damaging Het
Bmpr1b A T 3: 141,857,430 V251D possibly damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Catsperd A G 17: 56,659,554 D508G probably damaging Het
Cfap54 A G 10: 92,874,943 probably null Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chga A T 12: 102,562,951 R396* probably null Het
Cntnap3 T C 13: 64,778,876 E560G probably damaging Het
Csmd1 T C 8: 15,921,759 T3024A probably damaging Het
Csrnp1 CCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTC 9: 119,972,775 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah2 A T 11: 69,423,126 M4140K probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Eftud2 A T 11: 102,864,771 D203E probably damaging Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Faf1 C T 4: 109,890,941 A481V probably benign Het
Fat2 A T 11: 55,262,829 V3519D probably damaging Het
Fbln7 C A 2: 128,877,511 A76E probably benign Het
Galnt1 A T 18: 24,254,525 K49N probably benign Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Grk1 T C 8: 13,409,279 Y277H probably damaging Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Ier3 T C 17: 35,822,108 I94T possibly damaging Het
Il11 T C 7: 4,776,024 T36A probably damaging Het
Il5ra A T 6: 106,731,890 D296E probably damaging Het
Itk A T 11: 46,331,989 V551E probably damaging Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Kif5a A T 10: 127,235,652 S776T probably benign Het
Klrb1c T C 6: 128,780,403 E233G probably benign Het
Kpna7 T C 5: 145,007,994 K12R possibly damaging Het
Lhpp C T 7: 132,610,677 probably benign Het
Lhx8 A T 3: 154,328,171 probably null Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magel2 T A 7: 62,378,030 H227Q possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mapkbp1 T A 2: 120,023,151 M1152K probably benign Het
Mcoln3 T A 3: 146,140,576 L547* probably null Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Myom2 T C 8: 15,104,123 V687A probably benign Het
Nav1 C A 1: 135,452,207 V1586F possibly damaging Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Nfam1 T C 15: 83,001,483 T223A probably damaging Het
Nrcam T A 12: 44,551,341 V371E probably damaging Het
Nup210l A G 3: 90,180,211 Q1097R probably null Het
Obox5 T A 7: 15,757,646 M37K probably damaging Het
Obscn A T 11: 59,061,530 N4270K probably benign Het
Olfr1008 T C 2: 85,689,839 S137P possibly damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Olfr802 A G 10: 129,681,839 M300T probably benign Het
Olfr893 G A 9: 38,209,064 A2T probably benign Het
Olfr995 T A 2: 85,438,286 S291C probably damaging Het
Patj G A 4: 98,674,308 E1505K probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Ppp1r36 G A 12: 76,418,967 E43K probably damaging Het
Ptch1 C T 13: 63,520,307 V939I probably damaging Het
Rgs22 C A 15: 36,092,938 K396N probably damaging Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Ryr3 A T 2: 112,661,701 F3743L probably damaging Het
Scn7a C T 2: 66,675,740 G1602R probably benign Het
Sftpc A T 14: 70,522,670 V49E probably damaging Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slco4c1 A C 1: 96,867,920 S138A possibly damaging Het
Snd1 T C 6: 28,724,956 I501T probably benign Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tbc1d9b G A 11: 50,145,067 G130E probably benign Het
Tdrd6 T A 17: 43,625,561 D1532V probably damaging Het
Tekt1 T C 11: 72,351,952 D243G probably damaging Het
Tet2 A G 3: 133,486,666 L669S possibly damaging Het
Tnnt3 A G 7: 142,512,335 N201S probably benign Het
Trdn A G 10: 33,466,421 probably null Het
Trim36 T C 18: 46,178,456 E259G possibly damaging Het
Trpm1 C T 7: 64,220,254 P436S probably benign Het
Vmn1r183 T A 7: 24,055,501 L243Q probably damaging Het
Vps13b T C 15: 35,597,409 S1032P probably damaging Het
Vps37d T C 5: 135,076,541 E76G probably damaging Het
Vps72 A G 3: 95,121,304 H202R probably benign Het
Wdr75 T C 1: 45,819,602 S644P probably damaging Het
Wrn T A 8: 33,280,815 E697V possibly damaging Het
Xirp2 A G 2: 67,514,918 D2501G probably benign Het
Zfp472 T C 17: 32,975,962 W24R probably damaging Het
Zmym6 T C 4: 127,122,772 V782A probably damaging Het
Other mutations in Ada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Ada APN 2 163730316 missense probably benign 0.02
IGL02414:Ada APN 2 163730040 missense probably benign
IGL02973:Ada APN 2 163731133 missense probably benign 0.01
R0053:Ada UTSW 2 163732292 missense probably damaging 0.99
R0076:Ada UTSW 2 163727603 unclassified probably benign
R0305:Ada UTSW 2 163728157 missense probably benign 0.00
R0464:Ada UTSW 2 163732964 nonsense probably null
R0701:Ada UTSW 2 163730075 missense probably benign 0.30
R1474:Ada UTSW 2 163732894 missense possibly damaging 0.94
R4044:Ada UTSW 2 163735460 missense probably damaging 0.96
R4589:Ada UTSW 2 163732948 missense possibly damaging 0.94
R5114:Ada UTSW 2 163730486 missense probably benign 0.15
R5424:Ada UTSW 2 163728125 nonsense probably null
R5753:Ada UTSW 2 163735398 missense probably benign 0.00
R6392:Ada UTSW 2 163728217 missense probably damaging 1.00
R6501:Ada UTSW 2 163728188 unclassified probably null
R6646:Ada UTSW 2 163735423 missense probably benign
Z1088:Ada UTSW 2 163728116 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGCTTCATTGCCTCAAGCCC -3'
(R):5'- AGACCCCTAAATGTGGCAGAGACAG -3'

Sequencing Primer
(F):5'- TCAAGCCCCACGAAACCTC -3'
(R):5'- cagagccacgcccaaac -3'
Posted On2013-05-23