Incidental Mutation 'R0463:Snd1'
ID41476
Institutional Source Beutler Lab
Gene Symbol Snd1
Ensembl Gene ENSMUSG00000001424
Gene Namestaphylococcal nuclease and tudor domain containing 1
Synonymsp100 co-activator, Tudor-SN
MMRRC Submission 038663-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R0463 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location28475139-28935162 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28724956 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 501 (I501T)
Ref Sequence ENSEMBL: ENSMUSP00000001460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000171353]
Predicted Effect probably benign
Transcript: ENSMUST00000001460
AA Change: I501T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: I501T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164915
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167201
AA Change: I501T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424
AA Change: I501T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169321
Predicted Effect probably benign
Transcript: ENSMUST00000171353
SMART Domains Protein: ENSMUSP00000129497
Gene: ENSMUSG00000049939

DomainStartEndE-ValueType
low complexity region 29 39 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171532
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,737,060 probably benign Het
Abcd2 C T 15: 91,159,124 M620I probably benign Het
Ada T A 2: 163,730,351 I243F probably benign Het
Adam12 T C 7: 133,974,416 probably null Het
Adarb2 A T 13: 8,203,188 probably benign Het
Adk A C 14: 21,423,536 Q287P probably benign Het
Ahnak A G 19: 9,009,407 probably benign Het
Aoc3 C T 11: 101,331,606 R223W probably damaging Het
Aqp11 T C 7: 97,729,021 D229G probably benign Het
Arhgap28 A G 17: 67,896,225 S78P probably damaging Het
Bfsp2 T A 9: 103,426,655 E383D possibly damaging Het
Bmpr1b A T 3: 141,857,430 V251D possibly damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Catsperd A G 17: 56,659,554 D508G probably damaging Het
Cfap54 A G 10: 92,874,943 probably null Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chga A T 12: 102,562,951 R396* probably null Het
Cntnap3 T C 13: 64,778,876 E560G probably damaging Het
Csmd1 T C 8: 15,921,759 T3024A probably damaging Het
Csrnp1 CCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTC 9: 119,972,775 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah2 A T 11: 69,423,126 M4140K probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Eftud2 A T 11: 102,864,771 D203E probably damaging Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Faf1 C T 4: 109,890,941 A481V probably benign Het
Fat2 A T 11: 55,262,829 V3519D probably damaging Het
Fbln7 C A 2: 128,877,511 A76E probably benign Het
Galnt1 A T 18: 24,254,525 K49N probably benign Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Grk1 T C 8: 13,409,279 Y277H probably damaging Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Ier3 T C 17: 35,822,108 I94T possibly damaging Het
Il11 T C 7: 4,776,024 T36A probably damaging Het
Il5ra A T 6: 106,731,890 D296E probably damaging Het
Itk A T 11: 46,331,989 V551E probably damaging Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Kif5a A T 10: 127,235,652 S776T probably benign Het
Klrb1c T C 6: 128,780,403 E233G probably benign Het
Kpna7 T C 5: 145,007,994 K12R possibly damaging Het
Lhpp C T 7: 132,610,677 probably benign Het
Lhx8 A T 3: 154,328,171 probably null Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magel2 T A 7: 62,378,030 H227Q possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mapkbp1 T A 2: 120,023,151 M1152K probably benign Het
Mcoln3 T A 3: 146,140,576 L547* probably null Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Myom2 T C 8: 15,104,123 V687A probably benign Het
Nav1 C A 1: 135,452,207 V1586F possibly damaging Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Nfam1 T C 15: 83,001,483 T223A probably damaging Het
Nrcam T A 12: 44,551,341 V371E probably damaging Het
Nup210l A G 3: 90,180,211 Q1097R probably null Het
Obox5 T A 7: 15,757,646 M37K probably damaging Het
Obscn A T 11: 59,061,530 N4270K probably benign Het
Olfr1008 T C 2: 85,689,839 S137P possibly damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Olfr802 A G 10: 129,681,839 M300T probably benign Het
Olfr893 G A 9: 38,209,064 A2T probably benign Het
Olfr995 T A 2: 85,438,286 S291C probably damaging Het
Patj G A 4: 98,674,308 E1505K probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Ppp1r36 G A 12: 76,418,967 E43K probably damaging Het
Ptch1 C T 13: 63,520,307 V939I probably damaging Het
Rgs22 C A 15: 36,092,938 K396N probably damaging Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Ryr3 A T 2: 112,661,701 F3743L probably damaging Het
Scn7a C T 2: 66,675,740 G1602R probably benign Het
Sftpc A T 14: 70,522,670 V49E probably damaging Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slco4c1 A C 1: 96,867,920 S138A possibly damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tbc1d9b G A 11: 50,145,067 G130E probably benign Het
Tdrd6 T A 17: 43,625,561 D1532V probably damaging Het
Tekt1 T C 11: 72,351,952 D243G probably damaging Het
Tet2 A G 3: 133,486,666 L669S possibly damaging Het
Tnnt3 A G 7: 142,512,335 N201S probably benign Het
Trdn A G 10: 33,466,421 probably null Het
Trim36 T C 18: 46,178,456 E259G possibly damaging Het
Trpm1 C T 7: 64,220,254 P436S probably benign Het
Vmn1r183 T A 7: 24,055,501 L243Q probably damaging Het
Vps13b T C 15: 35,597,409 S1032P probably damaging Het
Vps37d T C 5: 135,076,541 E76G probably damaging Het
Vps72 A G 3: 95,121,304 H202R probably benign Het
Wdr75 T C 1: 45,819,602 S644P probably damaging Het
Wrn T A 8: 33,280,815 E697V possibly damaging Het
Xirp2 A G 2: 67,514,918 D2501G probably benign Het
Zfp472 T C 17: 32,975,962 W24R probably damaging Het
Zmym6 T C 4: 127,122,772 V782A probably damaging Het
Other mutations in Snd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Snd1 APN 6 28512986 critical splice donor site probably null
IGL00940:Snd1 APN 6 28745175 intron probably benign
IGL01340:Snd1 APN 6 28883369 missense probably benign
IGL01892:Snd1 APN 6 28888124 critical splice donor site probably null
IGL02063:Snd1 APN 6 28526221 unclassified probably benign
IGL02134:Snd1 APN 6 28880279 missense possibly damaging 0.81
IGL02366:Snd1 APN 6 28707150 intron probably benign
PIT4677001:Snd1 UTSW 6 28880296 missense probably benign 0.01
R0039:Snd1 UTSW 6 28745210 missense probably damaging 1.00
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0576:Snd1 UTSW 6 28886577 missense probably benign 0.31
R0709:Snd1 UTSW 6 28545470 splice site probably benign
R0959:Snd1 UTSW 6 28884971 missense probably benign 0.01
R1698:Snd1 UTSW 6 28888253 nonsense probably null
R1853:Snd1 UTSW 6 28545564 missense probably damaging 1.00
R2059:Snd1 UTSW 6 28745207 missense probably damaging 1.00
R2497:Snd1 UTSW 6 28888079 missense probably benign
R3832:Snd1 UTSW 6 28531404 splice site probably benign
R3833:Snd1 UTSW 6 28531404 splice site probably benign
R4643:Snd1 UTSW 6 28880249 missense probably benign 0.00
R4665:Snd1 UTSW 6 28707054 missense probably damaging 1.00
R4843:Snd1 UTSW 6 28668643 missense probably damaging 1.00
R4884:Snd1 UTSW 6 28526912 missense possibly damaging 0.94
R4959:Snd1 UTSW 6 28884251 nonsense probably null
R4973:Snd1 UTSW 6 28884251 nonsense probably null
R5065:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5066:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5067:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5131:Snd1 UTSW 6 28885050 missense probably damaging 0.99
R5172:Snd1 UTSW 6 28886616 missense possibly damaging 0.91
R5239:Snd1 UTSW 6 28545525 missense probably damaging 1.00
R5313:Snd1 UTSW 6 28668601 missense probably benign 0.15
R5395:Snd1 UTSW 6 28526184 missense probably damaging 0.99
R5938:Snd1 UTSW 6 28874859 critical splice acceptor site probably null
R6019:Snd1 UTSW 6 28880234 missense probably benign 0.00
R6248:Snd1 UTSW 6 28520235 nonsense probably null
R6337:Snd1 UTSW 6 28888289 missense probably damaging 1.00
R6810:Snd1 UTSW 6 28668610 missense probably benign 0.23
R6932:Snd1 UTSW 6 28626101 missense probably benign 0.42
R7469:Snd1 UTSW 6 28626127 missense probably damaging 1.00
R7485:Snd1 UTSW 6 28531450 missense probably benign 0.14
R7571:Snd1 UTSW 6 28526203 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTAGTGGAGCATCCCATGTCAACAG -3'
(R):5'- GCAAAATGTTGCTAGGGACAGAGCC -3'

Sequencing Primer
(F):5'- ATCCCATGTCAACAGTCTGCG -3'
(R):5'- TGTTCCAGGAATAGACAAGCTGC -3'
Posted On2013-05-23