Incidental Mutation 'R0463:Tnnt3'
ID41487
Institutional Source Beutler Lab
Gene Symbol Tnnt3
Ensembl Gene ENSMUSG00000061723
Gene Nametroponin T3, skeletal, fast
SynonymsfTnT, skeletal muscle fast-twitch TnT
MMRRC Submission 038663-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0463 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location142498836-142516009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142512335 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 201 (N201S)
Ref Sequence ENSEMBL: ENSMUSP00000101578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074187] [ENSMUST00000078497] [ENSMUST00000105941] [ENSMUST00000105942] [ENSMUST00000105943] [ENSMUST00000105944] [ENSMUST00000105945] [ENSMUST00000105946] [ENSMUST00000105947] [ENSMUST00000105948] [ENSMUST00000105949] [ENSMUST00000105950] [ENSMUST00000105952] [ENSMUST00000105953] [ENSMUST00000105954] [ENSMUST00000105955] [ENSMUST00000105957] [ENSMUST00000105958] [ENSMUST00000128294] [ENSMUST00000146804] [ENSMUST00000169299] [ENSMUST00000179658] [ENSMUST00000180152]
Predicted Effect probably benign
Transcript: ENSMUST00000074187
AA Change: N177S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073815
Gene: ENSMUSG00000061723
AA Change: N177S

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078497
AA Change: N197S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077587
Gene: ENSMUSG00000061723
AA Change: N197S

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
Pfam:Troponin 72 214 2.1e-42 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105941
AA Change: N177S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101561
Gene: ENSMUSG00000061723
AA Change: N177S

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 2.1e-42 PFAM
low complexity region 229 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105942
AA Change: N168S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101562
Gene: ENSMUSG00000061723
AA Change: N168S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.7e-42 PFAM
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105943
AA Change: N168S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101563
Gene: ENSMUSG00000061723
AA Change: N168S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.9e-42 PFAM
low complexity region 220 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105944
AA Change: N179S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101564
Gene: ENSMUSG00000061723
AA Change: N179S

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2e-42 PFAM
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105945
AA Change: N177S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101565
Gene: ENSMUSG00000061723
AA Change: N177S

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105946
AA Change: N183S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101566
Gene: ENSMUSG00000061723
AA Change: N183S

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105947
AA Change: N188S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101567
Gene: ENSMUSG00000061723
AA Change: N188S

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.9e-42 PFAM
low complexity region 240 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105948
AA Change: N179S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101568
Gene: ENSMUSG00000061723
AA Change: N179S

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2.2e-42 PFAM
low complexity region 231 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105949
AA Change: N173S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101569
Gene: ENSMUSG00000061723
AA Change: N173S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:Troponin 48 190 1.8e-42 PFAM
low complexity region 229 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105950
AA Change: N191S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101570
Gene: ENSMUSG00000061723
AA Change: N191S

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
internal_repeat_1 213 240 4.67e-5 PROSPERO
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105952
AA Change: N188S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101572
Gene: ENSMUSG00000061723
AA Change: N188S

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105953
AA Change: N191S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101573
Gene: ENSMUSG00000061723
AA Change: N191S

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105954
AA Change: N192S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101574
Gene: ENSMUSG00000061723
AA Change: N192S

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Troponin 67 209 1.9e-42 PFAM
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105955
AA Change: N184S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101575
Gene: ENSMUSG00000061723
AA Change: N184S

DomainStartEndE-ValueType
coiled coil region 1 36 N/A INTRINSIC
Pfam:Troponin 59 201 2.2e-42 PFAM
low complexity region 240 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105957
AA Change: N188S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101577
Gene: ENSMUSG00000061723
AA Change: N188S

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105958
AA Change: N201S

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101578
Gene: ENSMUSG00000061723
AA Change: N201S

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 2.1e-42 PFAM
low complexity region 253 269 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125649
Predicted Effect probably benign
Transcript: ENSMUST00000128294
SMART Domains Protein: ENSMUSP00000116223
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Troponin 49 107 3.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144259
Predicted Effect probably benign
Transcript: ENSMUST00000146804
AA Change: N174S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116087
Gene: ENSMUSG00000061723
AA Change: N174S

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Troponin 49 191 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153262
Predicted Effect probably benign
Transcript: ENSMUST00000169299
AA Change: N183S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127854
Gene: ENSMUSG00000061723
AA Change: N183S

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179658
AA Change: N201S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136278
Gene: ENSMUSG00000061723
AA Change: N201S

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 212 1.5e-36 PFAM
low complexity region 257 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180152
AA Change: N201S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137111
Gene: ENSMUSG00000061723
AA Change: N201S

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 5.1e-42 PFAM
internal_repeat_1 223 250 2.76e-5 PROSPERO
low complexity region 257 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, liver and kidney hemorrhage and thin diaphragm. Mice heterozygous for this allele exhibit growth retardation with mild skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,737,060 probably benign Het
Abcd2 C T 15: 91,159,124 M620I probably benign Het
Ada T A 2: 163,730,351 I243F probably benign Het
Adam12 T C 7: 133,974,416 probably null Het
Adarb2 A T 13: 8,203,188 probably benign Het
Adk A C 14: 21,423,536 Q287P probably benign Het
Ahnak A G 19: 9,009,407 probably benign Het
Aoc3 C T 11: 101,331,606 R223W probably damaging Het
Aqp11 T C 7: 97,729,021 D229G probably benign Het
Arhgap28 A G 17: 67,896,225 S78P probably damaging Het
Bfsp2 T A 9: 103,426,655 E383D possibly damaging Het
Bmpr1b A T 3: 141,857,430 V251D possibly damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Catsperd A G 17: 56,659,554 D508G probably damaging Het
Cfap54 A G 10: 92,874,943 probably null Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chga A T 12: 102,562,951 R396* probably null Het
Cntnap3 T C 13: 64,778,876 E560G probably damaging Het
Csmd1 T C 8: 15,921,759 T3024A probably damaging Het
Csrnp1 CCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTC 9: 119,972,775 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah2 A T 11: 69,423,126 M4140K probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Eftud2 A T 11: 102,864,771 D203E probably damaging Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Faf1 C T 4: 109,890,941 A481V probably benign Het
Fat2 A T 11: 55,262,829 V3519D probably damaging Het
Fbln7 C A 2: 128,877,511 A76E probably benign Het
Galnt1 A T 18: 24,254,525 K49N probably benign Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Grk1 T C 8: 13,409,279 Y277H probably damaging Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Ier3 T C 17: 35,822,108 I94T possibly damaging Het
Il11 T C 7: 4,776,024 T36A probably damaging Het
Il5ra A T 6: 106,731,890 D296E probably damaging Het
Itk A T 11: 46,331,989 V551E probably damaging Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Kif5a A T 10: 127,235,652 S776T probably benign Het
Klrb1c T C 6: 128,780,403 E233G probably benign Het
Kpna7 T C 5: 145,007,994 K12R possibly damaging Het
Lhpp C T 7: 132,610,677 probably benign Het
Lhx8 A T 3: 154,328,171 probably null Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magel2 T A 7: 62,378,030 H227Q possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mapkbp1 T A 2: 120,023,151 M1152K probably benign Het
Mcoln3 T A 3: 146,140,576 L547* probably null Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Myom2 T C 8: 15,104,123 V687A probably benign Het
Nav1 C A 1: 135,452,207 V1586F possibly damaging Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Nfam1 T C 15: 83,001,483 T223A probably damaging Het
Nrcam T A 12: 44,551,341 V371E probably damaging Het
Nup210l A G 3: 90,180,211 Q1097R probably null Het
Obox5 T A 7: 15,757,646 M37K probably damaging Het
Obscn A T 11: 59,061,530 N4270K probably benign Het
Olfr1008 T C 2: 85,689,839 S137P possibly damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Olfr802 A G 10: 129,681,839 M300T probably benign Het
Olfr893 G A 9: 38,209,064 A2T probably benign Het
Olfr995 T A 2: 85,438,286 S291C probably damaging Het
Patj G A 4: 98,674,308 E1505K probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Ppp1r36 G A 12: 76,418,967 E43K probably damaging Het
Ptch1 C T 13: 63,520,307 V939I probably damaging Het
Rgs22 C A 15: 36,092,938 K396N probably damaging Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Ryr3 A T 2: 112,661,701 F3743L probably damaging Het
Scn7a C T 2: 66,675,740 G1602R probably benign Het
Sftpc A T 14: 70,522,670 V49E probably damaging Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slco4c1 A C 1: 96,867,920 S138A possibly damaging Het
Snd1 T C 6: 28,724,956 I501T probably benign Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tbc1d9b G A 11: 50,145,067 G130E probably benign Het
Tdrd6 T A 17: 43,625,561 D1532V probably damaging Het
Tekt1 T C 11: 72,351,952 D243G probably damaging Het
Tet2 A G 3: 133,486,666 L669S possibly damaging Het
Trdn A G 10: 33,466,421 probably null Het
Trim36 T C 18: 46,178,456 E259G possibly damaging Het
Trpm1 C T 7: 64,220,254 P436S probably benign Het
Vmn1r183 T A 7: 24,055,501 L243Q probably damaging Het
Vps13b T C 15: 35,597,409 S1032P probably damaging Het
Vps37d T C 5: 135,076,541 E76G probably damaging Het
Vps72 A G 3: 95,121,304 H202R probably benign Het
Wdr75 T C 1: 45,819,602 S644P probably damaging Het
Wrn T A 8: 33,280,815 E697V possibly damaging Het
Xirp2 A G 2: 67,514,918 D2501G probably benign Het
Zfp472 T C 17: 32,975,962 W24R probably damaging Het
Zmym6 T C 4: 127,122,772 V782A probably damaging Het
Other mutations in Tnnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Tnnt3 APN 7 142508325 intron probably benign
IGL02376:Tnnt3 APN 7 142512558 missense possibly damaging 0.64
R0432:Tnnt3 UTSW 7 142512086 missense probably benign 0.09
R1421:Tnnt3 UTSW 7 142511366 missense probably damaging 0.97
R1521:Tnnt3 UTSW 7 142515825 nonsense probably null
R1789:Tnnt3 UTSW 7 142512364 missense probably damaging 1.00
R1990:Tnnt3 UTSW 7 142511525 missense possibly damaging 0.78
R1991:Tnnt3 UTSW 7 142511525 missense possibly damaging 0.78
R2029:Tnnt3 UTSW 7 142512627 splice site probably benign
R2216:Tnnt3 UTSW 7 142512564 missense probably benign 0.03
R4779:Tnnt3 UTSW 7 142514283 intron probably benign
R5568:Tnnt3 UTSW 7 142512040 missense probably damaging 0.98
R5756:Tnnt3 UTSW 7 142502758 critical splice donor site probably null
R5994:Tnnt3 UTSW 7 142511266 missense probably damaging 1.00
R6265:Tnnt3 UTSW 7 142501645 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGGTGCCAACTACAGCAGCTAC -3'
(R):5'- GCCTTGTCCCTGGAAGATGGAAAAG -3'

Sequencing Primer
(F):5'- GTAAGGGACATACTCAGAACCCTG -3'
(R):5'- TGGAAAAGAGGGGGTTTGATG -3'
Posted On2013-05-23