Incidental Mutation 'R0463:Cfap54'
ID41501
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission 038663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0463 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 92874943 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
Predicted Effect probably null
Transcript: ENSMUST00000168110
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212902
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,737,060 probably benign Het
Abcd2 C T 15: 91,159,124 M620I probably benign Het
Ada T A 2: 163,730,351 I243F probably benign Het
Adam12 T C 7: 133,974,416 probably null Het
Adarb2 A T 13: 8,203,188 probably benign Het
Adk A C 14: 21,423,536 Q287P probably benign Het
Ahnak A G 19: 9,009,407 probably benign Het
Aoc3 C T 11: 101,331,606 R223W probably damaging Het
Aqp11 T C 7: 97,729,021 D229G probably benign Het
Arhgap28 A G 17: 67,896,225 S78P probably damaging Het
Bfsp2 T A 9: 103,426,655 E383D possibly damaging Het
Bmpr1b A T 3: 141,857,430 V251D possibly damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Catsperd A G 17: 56,659,554 D508G probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chga A T 12: 102,562,951 R396* probably null Het
Cntnap3 T C 13: 64,778,876 E560G probably damaging Het
Csmd1 T C 8: 15,921,759 T3024A probably damaging Het
Csrnp1 CCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTC 9: 119,972,775 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah2 A T 11: 69,423,126 M4140K probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Eftud2 A T 11: 102,864,771 D203E probably damaging Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Faf1 C T 4: 109,890,941 A481V probably benign Het
Fat2 A T 11: 55,262,829 V3519D probably damaging Het
Fbln7 C A 2: 128,877,511 A76E probably benign Het
Galnt1 A T 18: 24,254,525 K49N probably benign Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Grk1 T C 8: 13,409,279 Y277H probably damaging Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Ier3 T C 17: 35,822,108 I94T possibly damaging Het
Il11 T C 7: 4,776,024 T36A probably damaging Het
Il5ra A T 6: 106,731,890 D296E probably damaging Het
Itk A T 11: 46,331,989 V551E probably damaging Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Kif5a A T 10: 127,235,652 S776T probably benign Het
Klrb1c T C 6: 128,780,403 E233G probably benign Het
Kpna7 T C 5: 145,007,994 K12R possibly damaging Het
Lhpp C T 7: 132,610,677 probably benign Het
Lhx8 A T 3: 154,328,171 probably null Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magel2 T A 7: 62,378,030 H227Q possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mapkbp1 T A 2: 120,023,151 M1152K probably benign Het
Mcoln3 T A 3: 146,140,576 L547* probably null Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Myom2 T C 8: 15,104,123 V687A probably benign Het
Nav1 C A 1: 135,452,207 V1586F possibly damaging Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Nfam1 T C 15: 83,001,483 T223A probably damaging Het
Nrcam T A 12: 44,551,341 V371E probably damaging Het
Nup210l A G 3: 90,180,211 Q1097R probably null Het
Obox5 T A 7: 15,757,646 M37K probably damaging Het
Obscn A T 11: 59,061,530 N4270K probably benign Het
Olfr1008 T C 2: 85,689,839 S137P possibly damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Olfr802 A G 10: 129,681,839 M300T probably benign Het
Olfr893 G A 9: 38,209,064 A2T probably benign Het
Olfr995 T A 2: 85,438,286 S291C probably damaging Het
Patj G A 4: 98,674,308 E1505K probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Ppp1r36 G A 12: 76,418,967 E43K probably damaging Het
Ptch1 C T 13: 63,520,307 V939I probably damaging Het
Rgs22 C A 15: 36,092,938 K396N probably damaging Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Ryr3 A T 2: 112,661,701 F3743L probably damaging Het
Scn7a C T 2: 66,675,740 G1602R probably benign Het
Sftpc A T 14: 70,522,670 V49E probably damaging Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slco4c1 A C 1: 96,867,920 S138A possibly damaging Het
Snd1 T C 6: 28,724,956 I501T probably benign Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tbc1d9b G A 11: 50,145,067 G130E probably benign Het
Tdrd6 T A 17: 43,625,561 D1532V probably damaging Het
Tekt1 T C 11: 72,351,952 D243G probably damaging Het
Tet2 A G 3: 133,486,666 L669S possibly damaging Het
Tnnt3 A G 7: 142,512,335 N201S probably benign Het
Trdn A G 10: 33,466,421 probably null Het
Trim36 T C 18: 46,178,456 E259G possibly damaging Het
Trpm1 C T 7: 64,220,254 P436S probably benign Het
Vmn1r183 T A 7: 24,055,501 L243Q probably damaging Het
Vps13b T C 15: 35,597,409 S1032P probably damaging Het
Vps37d T C 5: 135,076,541 E76G probably damaging Het
Vps72 A G 3: 95,121,304 H202R probably benign Het
Wdr75 T C 1: 45,819,602 S644P probably damaging Het
Wrn T A 8: 33,280,815 E697V possibly damaging Het
Xirp2 A G 2: 67,514,918 D2501G probably benign Het
Zfp472 T C 17: 32,975,962 W24R probably damaging Het
Zmym6 T C 4: 127,122,772 V782A probably damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.28
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACATAGCCAGCATTCTGTGTGCATC -3'
(R):5'- GCTAAGCTTTGTGTCCGTCATAGCC -3'

Sequencing Primer
(F):5'- TCTGCTTAGCGTCTCCAAAGAG -3'
(R):5'- GAGGCTGAAGCTAATGTCCT -3'
Posted On2013-05-23